GenePrediction:GLEAN_3697 Details

Name: GLEAN_3697
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:362084..363551 (+ strand)
Length: 1468
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:362084..362414 (+ strand)
Length: 331
Type: CDS
Source: GLEAN
Position: GCSC_113:362950..363551 (+ strand)
Length: 602
>GLEAN_3697 class=GenePrediction position=GCSC_113:362084..363551 (+ strand)
ATGACAGATATTATGTCCCTCCAGTACCCGCCGCCACCGAACGGCACCAATATTGCTCTTCAGCAGCCCGGATACTTGCC
TGCAGAGTACTCGAGCATTCATTCACCAACCGGACTTGTACAAGACACCAACATGCCTCCCAAAGGGCGCCATGATCCCA
TAACAAAGAACCTCAACATGAGGCTCGCGAAGTCCTTGTCTACGCCTGCTTCATTAAAGTCAGCTGCGGTGCAACAGCAA
GTTTCCCTTTCACAAGATCAAAACGCTCTCAGCTTGGCCGCTGAGAAAAGAAGAAATAAGCTTGGCTACCACCGGACTTC
TGTGGCGTGTGGTATGTAAATCTTTATTCTTTTCAATAAAAAACGCTCGTGGTGGTCTGTAATAGGTTGCCCGTGCCGTT
GAGAATATGATTATTGAATTCCAGTCTAACTTCGGGTTGTTATCGTTCTCACAAGGCCACTGTCGTCGGCGCAAAATCAG
ATGCATACCATCAGCGACAGATATCCAGGGACGATGTGCCAACTGCATCCGTCTCAAGAAGGAATGCAGCTTTTATCCAG
TAGATCAGCAACCACCAATTGACACGAGGAAAACCTCCATGTCCCGACCCTCGGTAGGCCTGTCACCACCGTCATCAAAA
TCATCTACAGCGGCTCTAGTTTCGAATCATAGCATTGGCCTCATAAAATCCGAGATCATCGAACGACCACCGAGCTCGAA
AGTACTGACCAAGCATTCGATACAGACTATGGCACCCCCGATAATGAAAGCAACTGGGACGGAAGCATATTCGCCAGAAT
CTAAAAGTAGGTATAATTCCTTCCTTGAAGACACACGACAAGACATAACTAAATGTCTCTTTATAGTGTCCTTGACGTCT
TCTGTTGGCCGAGCTTTTGAGTACAGCAACAGTGGGATGCCGAACTGGATGTCCGCAGACGTCAGTCCCAACTCGGCGAA
GCCGGGCGACTTGGGTACTCCCTGGAGACCATATCCGCAGGAATCTCCCACCACACCAGTCTTCACGTCGTATACACAGC
ACACAACAGCACCATCGGCAACTTGGGCGCAACATCCCGAACCAGCAGCAAGAGAGGACATGTGGTATCCCACACCTACC
CCAAGGTCCCTCTCTTTTGGGACAGAAAGCGTGGTTGGCAATCACGCTCAGTATCCGCCTATTTCACAAATGACAAGCGG
CCTGCCAACTCGGCCGTTCGACCGCAAATCTGGATCCATGCCTGAAATATATCATTCTTCGATCAACACTGCCGGCACTT
CTTTGGACACAGTCTCGCTTTCGGCCGGGACTGAAGGAACTCAGTCATACGATGGCTGGCAGCCGTACTCGTACGGCAAG
CCCAACGATTCATCCGATGCCTACGTCGGATGGGGTGGGGAGCAAGCCACATCTTCGGCAACCGAAACGCACGCGACTTC
GTCTAATGTGTATTACACCGGCCGATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62