GenePrediction:GLEAN_3698 Details

Name: GLEAN_3698
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:366121..366929 (+ strand)
Length: 809
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:366121..366443 (+ strand)
Length: 323
Type: CDS
Source: GLEAN
Position: GCSC_113:366594..366744 (+ strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_113:366855..366929 (+ strand)
Length: 75
>GLEAN_3698 class=GenePrediction position=GCSC_113:366121..366929 (+ strand)
ATGCAACGGCGACGGTCCACACCCCGAAAGCACTACGATTCCTCCGGGTCCCCCCTTATCACAGACAGCATTGGTAGTGG
CCACGCCAGTGCCGCCAACAGAGCTGCAAACACCACGTCTTCCCGTCGGACGAGCGCGGGCATCGAACTGCGCGAGCTAC
CGTCCCACGCCAGCAGCAGCAGCATCAGCCGGCCATTTCACCGCGTCGCAGACGTCCCGGATAACGCCTACTTCCCACCA
TCATACCACGCACAGCGCGTGCCGTTTGAGGACACGCCGCTCATCATGAAGCCACTCGTTAGCGCCGTGCAGGCTTGGTC
TTGGTGCGTACATTCCGTTGCTGCTTGCTGCTTCCTGCTTCCAGCTGGTTGCATCTTCTTGCCGGATCGATTGGGGTAGA
CGCTGCAGGCTGAAAGTCATCGGCTCCGAGCTCTCCTGATAACAGACGTGCTGCTGACACTTGATGGCTGAAGCTTCGTC
ATCTCGGTGTTTGCCATAGTCATCCTGTCCACTTTAGGCCTGCTCTTCCGCGGTAACCACCATGAGATGGTCGGTGGCAT
GAAAGACCCTGAGAATGGGCCGGAAGTTGCGGCCACCATCTTTGTGGCTGTTCTGGTTTACGCTGTACGTCCCCATGGCA
AGAAAGGGAGAAGCTCCCTGTCCCCCCCCTTTCTTGTCTACATTTCTGTTTTATCGGAGAGCGCCTGCTGACATACTCGC
GTTCTTATCGACAGGGGTTTTTGGTGTTCTGCGGCCTGCAGGGAATGATGCATCTTCGTGAGAATCGGCGAGGCGCAATC
GCATTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62