GenePrediction:GLEAN_369 Details

Name: GLEAN_369
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1342909..1344130 (+ strand)
Length: 1222
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1342909..1343286 (+ strand)
Length: 378
Type: CDS
Source: GLEAN
Position: GCSC_167:1343348..1343554 (+ strand)
Length: 207
Type: CDS
Source: GLEAN
Position: GCSC_167:1343639..1344130 (+ strand)
Length: 492
>GLEAN_369 class=GenePrediction position=GCSC_167:1342909..1344130 (+ strand)
ATGGCCCCCTCCCTGCTCCATCCGCCGAGCCGTCTGTCGGCAGCAGAGGCCCTTCTGCTGTCGCAGCGTGCGCCCGCCGT
GCTCGACAGCCTTCCCAGCACGGTCAGCTCGTCTATGCTGCAGTCGGTCATCGCGCCGACTGACGACCCCGAGATCTGGA
TCTCCTACGAGAATCTGCTGCTGTCGTGTCTGCGGACGGGCGACATTGAGTCGGCGCGCGAGAGCTTGCGCCGCCTCGTC
GGCCGCTTCGGCGAGAGCAACGACCGCATCAAGGCGCTGGGCGGCATCGTGCGTGAGGCCGAAGCCGAGGACGAGACAGC
CCTGCTGGAAGTGCTTAAGAGCTACGACTCTATCCTGAAGGAGGACGACAGCAACATTGTTGGTCTTCCCCCCCGCCAGA
ACTCTCGGCACACGACGTCTTGCTGACCGCACGCAACAGGCCATCCACAAACGACGCGCTGCCCTATTGCGCTCACTGGG
TCGCATCCCTGAGGCTGTCTCGGCCCTGGTGGCCCTTCTGGACTTCACGCCCACCGATGCCGAGGCCTGGGCTGAGCTGT
CCGACGTGTACCTATCGCAGGGCATGTACCCACAGGCCGTCTACGCCCTAGAGGAGGTGCTTGTGCTGGCGCCCAATGCT
TGGAATGTATGTCTTTCCGTTCCTCCTCTCTCTTCTCGCATGCATATCATTTCCCCCTTTCGGAACAGGCGGCTGACCGA
TCTGCTGCAGGTGCACGCCCGTTTGGGCGAAGTGCAGTATATGGCTGCAACGACATCTGTCAGTGGCGACGCCGTGTCGC
AGCAGAAGTACACGGCCGAATCGTTGAAGCGTTTCAGTCGCAGCATCGAGCTCTGCGACGACTATCTGCGTGGCTATTAC
GGTCTCAAGCTTGTACGATCACAAAACTCTCCCTCACTTACCACCCTGCAGTGCACGACCAGCACAGAATCAACTGACAA
AGCCCATTTCGGTGGCATGCAGGTCACGGCATATGCGATCGAAAATTCTGGAAAATGGCCCAAACGAAGCGTTGACACGG
AGGACTTTGCCCTACCGGACACTGCCACCCTGCAGCTGCTTAGTCAGCTGGCGACCGAGAAGCTGTCAGAAATCGTACGG
CGCGGTTCTGCAAAGGAACCCCACTGGAGTGGATATGACCAGGCCGAACTTGCAGCAGCACGGAAATTACTCGCGCAGGA
GACGGCCTCGACTGTTCGATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62