GenePrediction:GLEAN_36 Details

Name: GLEAN_36
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:268281..270740 (+ strand)
Length: 2460
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:268281..268611 (+ strand)
Length: 331
Type: CDS
Source: GLEAN
Position: GCSC_179:268852..270740 (+ strand)
Length: 1889
>GLEAN_36 class=GenePrediction position=GCSC_179:268281..270740 (+ strand)
ATGTCGACCAGCGCCGCCTTGCCCTCCGGGCAGTTCATCACGAGCATAGGCGGAAAGCGTTGTACGGCTGTGCCCCGAAA
CATCACAAGCACCGGCAGCTCCAACGGCAGCGCCGCGACTGCGACGCTCTCCTCTTTCTCCTCATCCTCCTCCTCCTCTT
CTTCCCTCGCACCCTCTTCGTCCTCCTCCTCCAAAAAAGCTGCCGAGACGACGACGAGTAGCATCATCAGAAGCAGTACC
ACTAGTGCCGCTGCAATCAGCAAAAGTACACAGGCAACGGCCAACGGGGCCGCCATTCCTGCCCCGGCCGTGATCGAGGC
ATCTACTCAGAGTACGACGAGCGTTTCCTCCACACCACTACCGTCACCGTCATCATCATCACTGCCACGGCCGCAATCGA
CATCACCAGTGCTGTCATCCTCCCCACCTTTATCCTCATTTGCATCTCCATCTCTGTCACCCTCCCCTTCACCGTCATCT
TCCCCCATTAAAGAGTCAGCTGTGGTGCCTCCAGCGGTCGTTGTTGCAAGTGGTTCATCTGACACTGCCTCTACTGTTGC
TGATGTGCCAGAATCGACAGCTACTGATATCTCGTCATCCGTACCTGCTCATGCCCCGTTCGCTGCCATAACACCTGTTG
GTACCGTGCAGTCCAGTCAAACGGATAGCGGCGTCATAGCCAGCCCGACTGCAGCTTCGGCTACATCCGTTTCCGTTATC
GTCACCTCGACGACACCAACGGCGGAGGCAGACGTTGGTCAGACAAGCAGCTTCCCACTACTCTCGGCCACGTCCAGTAC
ACCCCAAAGCAACCCCTCCAGCAACCCCTCCAGCAGTACGGCAGTAGCCGCTTTCACCACCGACGGCGGCGATGCCTCGT
CCTTTATCACATCTGTCCAGCTTAGTACAACCGATGGCGCCTCTTCCACAACATTAGCCGTAGTCACAACTACGAACAGT
TTGAGCAACAGCGGGGCCAGTGCAGGCTCGTCAACTCTGAAGAGCACTTCATCGAAAACGAATTCAAGCAATACCGCAGC
TGTGGTTGGCGGCGTCATTGGCGGTCTGGCATTGCTGAGCCTGGTGGCACTGCTGCTGTGGCTATGGCGGCGCCGGTTGA
GACAGAAGCGCCGAAGCACACTGCTGACGCCGTTGTCGGCGGACCCGGCAGTAGCTGCAGGACGCGGAAGACAGCGTGAT
CAAGCAGGCCAGGTCGGTGGCGTCAGCGAAAAGGGTGCCTACGAGATCAACCGCGGCAGCATTGGCCCGACTCCGGTAGC
TACACGCATGAAGGCTTCCATCACCTATAACCTACAGCAGGCACGCAGCCGGGTTGAAGGACTGCTGAGTGGTGGCGGGC
GGACCATGCTCCCAGGGGCAAGAGGAACATCACCGCAGCCGAGCGTGAACATGAACAGAGGCAACTCACAGTTCGGCAAT
GACAATATGGGAAGTCGCAAAGTCGGGTTGACTCCTCTCGACCGCGCCAAGGACTGGTGGAGCCGTATGGCGAACAATGC
GAGCATTCGTCTGCGACAGATGCGTGGTGAAAACGGCGGCGGCATGTACAAGACAAGCGCAGGGGCAGTGTCCGTGCGAG
GCACTGCGCCGTTGGCAAGCGGAAATGGCAGCCAGCAGCAGCCTGACTTTTTAACGCTGCTGGGTATGGACGAGAACGAG
CTGTCACGGGCAGCCCAGAACAAGCGCACCAAGAAGCGGCGCTCCAATGGCGGCAGCAGCAGCAGCAACAACTTTCTCGG
CCCCCTCAGTGTCGACTATTCGAACAACCCGTTTAGCGACAACAATGTGCTGGACGGCAGCCCAGCAGCTGGCCAAGCTA
CTACTGCAAGCCGGAATCCCTTTTCGGACGACTACGCTGCCATGCCCACTTTGCAACCCAATACGTACGCGGCCGGTCCG
AGACGTTCACGGGGACAGGCTGCAACGCCATTGCCACAGCCACTGCCACCGCCGCCTCCGGAACCGGCTTCGTCCAGCAG
AGAACCTGCTTCTCGTGCATCCAGCAGTACAGTTGCTACCGTTGACACCCGCCGCAACCGCTTCCGGTCCGATCCATTCG
ACCTCGAGCGACCCGAGCGACTACAGGTGTCGGGAGTGCGCGAGCCGATGCCGGCTGCGATGGCTGCGACACCGTCTACC
CTGGGCACGTTTGGCGGCCAAAAGCTGGGCGGGCAGGCCGGTGTGCGTATCTCCGGCAGGAGCAGGAGCGATAGCCGTCC
TGCCAGCAGCACGTACACACGCACTGCCAGCTTCACGAGCAAGTACTCGAGCGGCGCAAGCATGTACGGCTGGAATGAGC
CCGGTCCAGATGTCGGGCCGGTAACAACGCAATGGGACGACGCTGAGGCAGAGAATAGTGGTCTCTCGAATAAGAGAAAG
AGCGAGCTGCAACGGAATCACAGCACCGGCAGTGGCACCAGCGTGGGCAAGGCTTTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62