GenePrediction:GLEAN_3700 Details

Name: GLEAN_3700
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:386433..388132 (+ strand)
Length: 1700
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:386433..386609 (+ strand)
Length: 177
Type: CDS
Source: GLEAN
Position: GCSC_113:386675..386754 (+ strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_113:386821..388132 (+ strand)
Length: 1312
>GLEAN_3700 class=GenePrediction position=GCSC_113:386433..388132 (+ strand)
ATGGCGATCGGCTTCAAGGTGAGGGACCTGTGGAGGGCCCCGGTCCTCAATCCGATCAACCGGAAGGCCCGATCGATTCC
CTTTCTCAATCCGATCAATATGTATGGCCGGGTCTTCTTCTTCGCCTGGTTTGGCTTCATGATCGCTTTCTGGGCGTGGT
ATGCCTTCCCGCCGCTGGTACGCATGCAATCTGCCACCTTCCAACAGTACGTGGCAACAAGAGCTAACACTTTCTCCTGT
AGTTAACCGTCACCATCAAGAAAGACCTGAAACTCACACCGGCTCAGGTTGCCAACTCCAACATTGTGTCTCTAAGTGCA
ACGTACGTATCCTCCCAACGCTCCCTAGGCCGAGGCTAAATGTGCCGAATGTCTCTGACCGATGACAGGCTCTTGGTTCG
TATCATATCTGGTCCGTTGTGTGACCAATTCGGCCCTCGAATAGTGTTTGGCTTCATCCTTCTCCTCGGCGCCATCCCCG
TCGGCCTGTCGCCGCTCGTGCAATCGGCCGGCGGCCTCTACACGGCGCGCTTCTTTACCGGAATCCTCGGCGGCTCCTTC
GTCCCGTGCATGGTGTGGTCGACCGGCTTCTTCGACAAGAACGTTGTGGGCACGGCCAATGCTCTGACGGGCGGTTTTGG
CAATGCCGGCGGGGGGGTCACCTACTTCATCATGCCGGCTGTGTACGACTCGCTGAGAAAGCATCGGGGCTACAAGCCTG
ACAAGGCGTGGCGCGTGACATTCGTCGTACCGCTCATCATGGTCATCGCGACGGGTGTGGCGCTGCTCCTCCTGTGCCCA
GACACTCCGGACGGCAAGTGGAAAGATCGCGAGCTGCACGCCAAGAAGAATCTTGAGGAGCACAACGTCCATGTCGCGGC
GGCGCCGTCACCGGTCGTCGATGTTCCTGGCAGTATCATGGACAAGCAGCAGCGGTCCCGGACGGAGACGAGCAACGGCG
GTGGGACGGAGGATGCGATCAAGGACGACATCCGGTTCGTCGACCACGAGGCACACCTCGACAGGGATGAGATGCTGGAG
ACGGCTCAGGGCGAGATCGTGGTCAAGCCGACGGCCAAGGAGGCTCTGGAGGTGGCGGTCTCGCTGCAGACGGTGATGAT
TGTGCTGACATACATGTGCTCGTTTGGGGCGGAACTGGCCATCAACTCCATCCTGGCGGCGTACTACCTCAAGAAGTTCC
CGAAGCTGGGCCAGACGAAGGCATCCGACTGGGCGGCGATGTTTGCCTTCCTCAATCTTCTGACACGGCCGCTCGGCGGC
ATCATCTCGGACCTGCTCTACAACAGCTACGGGCGCAACCTCTGGCTGAAGAAGGGATGGATCACGATCTGCGGTGTGCT
GAGCGGCGTGTTCCTCATTGTCGTCGGCCAGGTGGACTCGCACAATGAATCGACCGTGTACGGGCTCATCGCGCTGGCGG
CCATCTTCATCCAGGCCGGCAACGGTGCCAACTTCTCGCTGGTGCCACACGTCCACCCGTTTGCCAACGGGATTGTGTCG
GGCTTGGCCGGTGCTGGCGGCAATATGGGCGGCATCTTCTTTGCTGTGATCTTCCGGTTCATGGACAACGGCACCAACTA
CGCAAAGGCGTTCTGGGTCATTGGCGTGATTCACATTGGCGTCAATCTGGCGGTGTCTTGGATTCCGCCTGTTCCCAAGA
ACCAGATTGGTGGCCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62