GenePrediction:GLEAN_3701 Details

Name: GLEAN_3701
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:394403..396712 (+ strand)
Length: 2310
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:394403..394589 (+ strand)
Length: 187
Type: CDS
Source: GLEAN
Position: GCSC_113:394690..396449 (+ strand)
Length: 1760
Type: CDS
Source: GLEAN
Position: GCSC_113:396575..396712 (+ strand)
Length: 138
>GLEAN_3701 class=GenePrediction position=GCSC_113:394403..396712 (+ strand)
ATGGCAGAAAAAAAGCACGCCAGAGACACGTCAGTGGACACGGACACGACCTCGACACCGACGTCGAGATTCCATCGCGA
CACGTCCGAGATGGCAGACGAAGCACGGAAAGATGGCGCAGAGGCGACGGTCCACAAGAGAAGCCATGCCGAGTTCTCTG
AGCAGGAAGCAGGCGGACAGGGCAATGGTAAGCACGGCCTCGACTTCCTGAGCTGATCTCGACTGATCTCGATTGATCTC
GATTGATCTCGACACGGGGAAGCTGACTAGTGCGGGTGATGATGCAGGCTCCGGCGTCGACTCGGATTCGGACTCGGACT
CGGACGACATGGGCCCGCAGCTGCCATCGGCGGCAGCAGCAGCGCCGAAGAAGAAGCGGCACCGGCTGATGCACGAGAAG
CTGTACGTCTCGGCACTGCCCAAAGCGAAGCGGTACTCCAAGTCGCTCATGCACAAGGAGCAGGTGGCGTTTCTGAGCAT
GACACCGGGCACGGACTTCCTCATCACGACCTCGGTGGACGGCGTGGTCAAGTTCTGGAAGAAGATCAACGAGGGCATCG
AGTTTGTCAAGCAGTTCAGCGCACACGTGGGCACGATCACGTCGGTGTCGGCGAGCCACGATGGACGCAGCTTCGCGTCG
GCGGGCGTGGACCGGACGATCAAGATCTTTGACGTGATGACGTTCGACCTGCTGTCGACGATCACGCTGGACTTTGAGCC
ACGCTGCATCTGCTGGGTTCACCGGCGGGGAGCACCGCTGCCGCTGCTGGCAGTGTCAGAGGCAGAGAAGCCGAACATAC
ACATCTACGACGGACGAGGCGAGGCGGGAGCACAGCAGGCGGCAGCAGGGCGGTCGAAGGTGGAGACTGGATCGACGCTG
CTGCAGCCGCTGCACACGCTGACGGCGATGCACCGCAGCGTGGTGACGCTGATGGCATACAACGAGGCGTTTGACTGCGT
GGTGTCGGCCGACGTGGGCGGGATGCTGGAGTACTGGCGGCCCAGCGGAACGTACAAGACACCAGACAACGTGTTCCGGC
TGAAGAGCGCGACGAGCCTGTACGAGTTCAAAAAGGCCAAGTCGGCGGCGACGGCGCTGACGATCGCGCCGACGGGACGG
CAATTTGCGACATTTTCGCTGCCAGACCGCAAGGTGCGGGTGTTTGACTTTGCGACGGGACGGCTGGCACGGGCATACGA
CGAGTCACTGCGCACGGCCGAGGACATGCAGCAAGCCGGCACGGCCGTACAGCAGCTGGACGCGGTGGAGTTTGGACGGC
GACTGGCGGCAGAGCACGAGGTGGAGACGGAGGCGCTGCGAGACAAGGCGAACGTGATCTTTGACGAGTCGGGACACTTT
CTGCTGTACGGCTCGATGCTGGGTGTCAAGGTGGTCAACACGGCGACGAACCAGGTGGTGCGACGATATGGGGCGGACGA
GAACTTCCGGGCGTTGCAGCTGGCGCTATACCAGGGCCAGCCACAGAAAAAGGGCGTGACGACGGTGGCGATGGCGGCGT
CGAGCAACCCGCTGCTGCAGGAGTCGGAGGTGCGCGACCCGATCCTCGTGGCCACGGGCGTGGGCAAGCAGCGGTTCTAC
CTGTTTACCAACCAAGAGGACGCGGCCAAGGGCTCGCGTGACGTGCTGAACGAGCGGCCGACGGCCAACAACGGCGGCCA
CGGCAGCAAGAAGGGCGGACGGGCAGCCAAAGAGGCTGAATCGGGCAGCGGCGCCGTGATCCACACGACCTACGGCGACA
TCCACATCCGGCTCTTCCCCGGATCGGCGCCCAAGGCGGTCGAGAACTTTGTCACGCACGCCAAGCGCGGCTACTACAAC
AACACCATCTTCCACCGGGTCATCCGCAAGTTTATGATCCAGGCCGGCGATCCGCTCGGCGACGGCACCGGCGGCGACAG
CATCTGGGACCGGCCATTCGAGGACGAGTTCAGCTCGCTCAAGCACGACAAGCCGTACACCGTCAGCATGGCCAACGCGG
GGCCCAACACCAACGGCAGCCAGTTTTTCATCACCACGGAGAAGACGGTACGTGCACGACGCGGACGCAGGCACAGGCAC
AGACGCATGCATGCAACTTTACCCGCTTGTCTTTACCCGCCTTTTTTTTCCTATCTGTGGAGCTCTGTACCTGCTAACAA
GCTCTCCTGCAGCCGTGGCTCGACAACAAACACACCATCTTTGGGCGGGCCTACCAGGGCATGGACGTCATCCACCGGAT
CGAGAACGCCCGGACATACAAGGAACGTCCTGAAGAGGACATCAAGATCCTCAACATTGACGTGTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62