GenePrediction:GLEAN_3702 Details

Name: GLEAN_3702
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:397893..400769 (+ strand)
Length: 2877
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:397893..397954 (+ strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_113:398072..398125 (+ strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_113:398203..399493 (+ strand)
Length: 1291
Type: CDS
Source: GLEAN
Position: GCSC_113:399545..400615 (+ strand)
Length: 1071
Type: CDS
Source: GLEAN
Position: GCSC_113:400683..400769 (+ strand)
Length: 87
>GLEAN_3702 class=GenePrediction position=GCSC_113:397893..400769 (+ strand)
ATGCCCCGACCGCGCAACCCAGATGGCCGGGAGCCAAAGAGTCGAAGCCGGAACGGCTGCTGGTGAGTTGACACTCTCCC
CGTCTCCTCTCCCCACCATCTATCATTGTACACCGCCCACGACTGCCTGTTCGTCTTGCCATGGACGTGCTGACATGCTG
ACATGGCGCTTTGCCACAGGTCTTGCAAGGCCAGAAAAGTCAAGTGCACCGAGGAACGTCCAAGTTGTGCCAAGTATGGA
GCATCCCACCAGACACCACCCACACCCCCTTTCCACTCTGTGCTTGCTGACGTTCCTGAACGGTGATCAGATGTGTCAAG
GGCGGCTATAAATGCGACTATGGCATCCGTCTGAACTGGGATGGCCGTCGGAGCAAGCGGCCACACCTCAAGGCCGTCCA
GCTCGGCGAGGGCGTGATGCTGGACGGCATCGATTTTGCTGATGATGGCGGCCAGCCAGATGACGGCCTCGAGGCCGAGA
CCTCCTTTCGCCAGCTACCATTGCCACAGCCCATTCAAGGCACTGACTCCTCTCCTCCCTCCACCGCCTCTTCGGCCTCT
TCCATGCCCTTGACCGCAAAGGGCTCTGGACAGTCGCTGAGCTTCATGCCGGTTCACGTGCCCTCCGGACCCGTCGCTCC
CTCGTCACGGTCCTCAAAGGCCGTCGCTGCCAGCACGACCAAAGCCGAGCTATCTTTTCAGAACTTCACGCCCGCAACGG
CATCCTCGCTCCCGACCACCTTTCGCTTCGAGGTGCAGACTTCGGCCGCTCCCGTCCGCAGGGCGTCTGCTTCGAGGGCA
AAGCGGACGCCCCGGGTTGCCGACACAGCGCGAGCCTCGCTGTCTTCCGTGGGCGCGGACACCTCTCTGGCTACTGACGA
TGTTCGGAGCGTGTCGTCCTCGGTGGGAACGGCCGACAGCCGGCGCCTGACGATGAAGCGGCCGCGCCTCGACTCGGACG
TGAGCGAGAAGGACTTTGCATGGCAGTGGCCCATCTCCCCCTCGGCCGGCTCCGGGTCGACGCAGTCTGTAGCCTCGCCC
CGTCAGACCGTGTTTCCGTCTATAACCTCTGCGCGGGCAGCCGGTGAGGTCTCCTCGCCACGACCTAGCGACGACAGCCA
GTCTCTGGCATCGCCCCACACCGCCAACACCCTTCTGCAGCTCCAGGCCGCCAGCGACTTTCGCCGTCTCAGCGTCAGCT
CGCTGCTCTCAGGGCCGGTCGACCTCGCCTCCGTCAGCACACCGCCAACTATGTCGGCAGGCCCGGATTCGCCACTGGAG
GCCGCGGCCGGCCGAGGAGAGCATCGGTCAAGCGGCAGGCATAACGGCCGGCACGAAGACAGGCACTTTGTCTATTATTA
CGGCATCGACTGCGGCATGCGTGACCTGGACTTGGGCACAAACGACGATGCGAATGCCACATCTGGCGTGGCCATCGATG
CTGGCAACTACGAGCCTCCACGCGACAGAGGACAGCCGCCGCTCGAAGAGGACTCGGGCCATGATCGGGGGGGCTACTAC
ACCAATCCGGTGGCCGTTCGGATCCCTCGTGCACTTGGACAGCTGCCTCCCAAACTGACGGAGAATCCAATGAACATGCT
GGTAAGCCAATCTTGCCTTCTTCATGTCTGGCTCCCCTCTGACAAGACGCAGTACTTTCACCATTTTATCAACCACACAG
CACGGATTCTCGTCCCCCATGATGACCCGCGGTCAAACCCGTTTCGCACTATCCTCCCTCAGATGGCTCTCATGAACGAC
AACCTTCTCAGCCTGTTGCTGGCTTACTCTGCTGCCCATCGCGCACACGTCTTGTGCCAGCCGGAGCCGGCTATGCGGAT
AGCCCTGTGGGTGCAGGACATCTTCCCTGCCCTTCGCAAAGCGCTGGACGACCACAAGAAGAAGATTTCCAACGCCAACG
TGGCGACAGCCATCATGCTGGCATCGCTGGCCATCCTGTCGCCCACGACATTTGGCTACAGCATCCCGTGGCAGACGCAC
TTGATGCTCGCTAGACAGATCATTGCTGCGCGGCCCGAGGGCCTGCGGGTGGATCACCACAGCACGCTGGAGGGACAGGT
GTGCTCCTTTCTCTGGAGCTGGTTTGCTTATATAGACGTCTTGGGCGGCCTGAGCGGCGGACCGACCGACGCCTCGCCCG
CCTGGATCCTAGACTACAAGGTGTACAACCCACAGGACGACGATGAGATTGACTGCATCATGGGCTTCACGACGCGCTGC
GTCTACATTTTGTCGCAGATTGCCGAGCTCGTGCGTGCATGTGAGCCTGAGCGACTTCGGCTGCAGGGTACCGGCTCGGA
AGCCTGGACGCCGAGTGAGGACCTCGTGCTCAGGGTCGAGTCTCTCAAGGTGGATGTGAACGACAGCAGGGTGCAGGTTC
CGCGGCCGTGTGCACACCTACACCGGACCGGCGACATCTTCCGCTGGGACCGGAAGGAGATGGAGGCGACGAACGAAGCC
TACCACTGGGCCGCGCTGGTCCATCTGGAGCGCCGGGTGTTGGGAAAGCCGTCGGACCATCCGGACGTGCAGGGGCCTTG
TCTTCGCATAGTGGAGTGCATTGACCAGGTGCGGTTTGGCGGCACGGCAGAGAACTGCCTGCTGTTCCCGCTGTTTACCG
CCGGCTGCGAATTGACGGATGTCGAGCTGCAAAAGGGGATGCTGAAGAGGATGATCAGCATTGAAGGCACCGCTATGATG
CAGGTAAGTCCAGCGCCCAGCTGCGTTCACCCTGTCTCGGCTGTGCAGCTGCTAACATGTGTGTCTGCAGGTGTCTAGTG
CGATGGCACTCATGAAACGGGCTTGGAGTACGAGGAAACCATGGGAGACGCTTTTGACCAGCGAGTTTATCGGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62