GenePrediction:GLEAN_3705 Details

Name: GLEAN_3705
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:417211..421590 (+ strand)
Length: 4380
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:417211..417855 (+ strand)
Length: 645
Type: CDS
Source: GLEAN
Position: GCSC_113:417950..418436 (+ strand)
Length: 487
Type: CDS
Source: GLEAN
Position: GCSC_113:418505..421590 (+ strand)
Length: 3086
>GLEAN_3705 class=GenePrediction position=GCSC_113:417211..421590 (+ strand)
ATGGATGTCACGCCTGAAACTGTGCGGCTTTCTATCACAGCCAGTGTCGCAGCTGTCAAGGACGATGGCGGAGACATTGG
CGGCCTTGAAGACACTGGAAATGTGATTGAGCCTTTGAGAAAGCGCAAATCTCTCGGGGATGGTCTCGACGATGCAGTAC
GGATAGAGGAACCCCAAGCCGGGGACCCTAAAAAGGTGAAGGTGGGCGACGATGGCCACCCCGAGCCTGCTGGCAAACTA
CCTGTCGTTGTCTCGGGCAGGGAGAGCATACCCCCAGAGATTTGGCATCACATCTTCACTTTTTGTCCCCCCAAAACATT
AGGGAATTTGTTGTGTGTCAACAAATTGTTTAATTTTTACCTCGATCCCAATTCTGCTGCAACGCCGACCGTGCCGCCTT
CTCCTCCCAAGTCTGCGACCAAACTTCAGAAGCCGAATGCTATCTGGCAAGCTGCAAGACGGTTGTATTGGCCCTATAAC
CCGGGCCCCCTAAAGGATAAGACCGAACTGGATATGTGGCGCTTGGCCTGCTCGCATGTTTGCCAGTTTTGTGGCAAGAA
AGACTCGCGGCGTGCTTTGCCTAGCAACGATCCATTACGCTTCGGGCCCGGAGCCGATGGCGTGACCTGCATCTGGGCAT
TCAGAGTACGATGCTGTGGTGCCTGTCTTTCTAGCAGGTCAATAAAGGTAAGCTTGGGTGCTTTTTTCTGTCTCTTAATG
GTCTCCTAATCCACCATAGGAAATGGACTTTCTTATGTCGAATGTCCCCTCCTTTCTTATACCAGCTTTGCCGTTTGTGT
TTTCTACGCCGGATTTGCATACAGTCCCCCCTAGCTTCATAGAGCGGGCCCAGTTTCCCGTATCTCTGTCTCTGACGAAG
CTATTCTGGTCCTTGGACGTTGAGAATCTAAACCGAGAGTTTCTAGCTGCTAAGGAACTGGGAGCCCCTGCTGTTGAGGA
ATGGCAGAAAGGGCTGGATCTACGAGGGCAAAAACAGAGATCCGACGTGGCAAAATGGGAGAAGTTTGACGACTCCGGTG
GTCTTAGCAAAACATTGCTTTATCCCGGCCACCAGCAAGCTGCAGCCGCCGCGGCCGCGCGTTCCATACCACAGACACAA
GATCAAGCTAAGAAGGACAAGGCGGCATTGCCAAGAGTGGCTGCATTGCCTCCGCGCCCGTCGTCTAGCGTCTCTCTTTC
ACCCCAGTGTCAGTTGTCGGCAGCTAGTAAGTTGCTGGTTGCCAGAAGTGTAAATGAGCTTTATTCGGACGATTTCAAAC
TGACATTGCCATAGCCGCAGCCCCAACATTTGGACTGCCATCTTTCCTTCCTTCAAAAGTTCTCCTTACAAAAGTGCCGA
TTCCACCTCGAGTTGAGCGCTCCAAGGAGGAAATAACGCAGCTGAAAGCCCAAAGGAGGGCCGAGATTATTCGCAGAGCA
GAACTGCTTAATCCTCCCATAACCGAGGATATTCTGGAGAAGACCACTGCTTTCCGTGCTGCAACACAAATCATCATGCC
TTTGGATGATATAGCCTGGGAAGTTCTGAAGCCGCGATTTCTGGCACAGAGAGCACAGCTGTCGAAAAGTCCATCTGTGG
CAAATGCTTCCAAGCAAACAGCACTGATTCCGGTTATCAAGGAAGTATCTTCGCAGGCTGAAACAGCCAAGGGAAAGACC
GACGCAGAATGGGACGAGATTCAGGGTCCGGTCCGGCTCAAAATCCTCAAGTACGCAGATGAAGTTATTCGAGATTGGGA
CAACGGCGAGAAGGTCAACAAAGAGAACGCACCCGCGTTTGCCATTGATGTGCTTCTGCATGTGCGAAAGCGTTTTTACA
TGGAGGTGGAAAAAGACGCCACAAGTGCTCGTTCTCAGAAACGGAAGCCAATTATCGACCCTCCCGAGGGACCGTTCACA
CAAAAACTGACGTTGGAAAACATGAAGTACGTCTTCGACATGAAGGTGCGCCCCCTGACGGAATCTCTGCGTAAGGAGCT
ATTTTTGTGCAGTGGCTGCGAAGGCAGTAACAAGCTCTTTGGATTCGACGGTGTGGTCCAGCACTATGCAGCCAAACACA
CTGAAACGCTCAGTCGCGGCAGCATCGTCGTCTACTGGAGAGCAGAATGGCCGCTTGCACCTATTTTTAAGGCGCTCACC
CGGCCGAGGAAGACTTTTCACCCACTTCCTGCGATTCCTCCATCGCTACCCGGCCCAAAACCAGTCGGCCTGCCTCCTCA
ACCTAGTTACAGCTCAGGCACAGCCGCACCAACGTTATTTACATCGGCATCGTTGGCACCTCAGCCATCCTACCCAGCGG
TGGGGTCGTTTCTTCCGATTGCGTCGCAACAACCTCCGCTTCAAAGTCCTTTTGCTTCGAACGTCACCTATTCCGCAAGC
CAGCCAGTCTTTGGGTCACAACAGCCAGTGCCACAGCAACAGCAATTCATAGTTCAGCCGTATGCGAACTCTGCACCCAG
TGTAGGACCTTTGGCCATGGCTGCAGTTTCGCAGAGGTACGGAGCAGCACAACCTCCGTCCCAATTTGGTGGCTCGCAAG
ATGTGTTGCCACCGGGACCAGGTCACATCGGGAACCAGAGCTATGGAAACAGCGTGCACCCGTCTACTTACGTTAGCGGG
TTTCCAGCTGAGAAGAAGCCAATACTGCCGTCAGCCAAATACAAAGGAGACTACAACAGGATGGCCATGCGTGCTCGTGA
GCTTTGGAGGTCGACAGCAAACATGGTGGACACACCGGGGGCTATCCGAGTTTTTACAGTCCTGAGTCATCTCGACAGTT
TTTTTCTGTCGAAAGTTGGAGAGCCTCTACCGATATCCCTCTTTCTCGAGGGGCTGTCGAATCACAAAGAGATGCGTCCG
GTTCGAAGCGTTGACGGCCTTTCATGCAAGCCGTGCCGCAATAGAGTTGGAACTGTACCTGATGAGGAGAAGCGGAAAAG
CTTTTCGTTGCCTCAGCTGGTCAGGCACTTTGAGACGTATCATACCGAGCCGACTCAGGGGAAACCCCGGCGTGGCTTGC
CATCATGCAACTGGTTCGCTGACATGCTGACTATCCCGCCTACGCACGCACTCCGAAGCATGGCAGGTCGCAATGGACGG
AAATACCCTCTTCTTTACGAAGCTGCGGTGAAATTGGAGAGAGAGACGGGCGAAAAAGAAGAGCGGACTCGACAGAAGCC
GGCCCAGGTACCCCGAGATATTGCGTCCTCTTCAAAAGCGCCTGGGGAGGTCCGCAGTAACCCAGTCACACAAAGGAGCA
AGGAGAACCCACGAGGGGGGCAGGACTTTGATCATAGGGATCGAGGTGGATCGTATTACTCTGCCGATCGGTATACACCG
TCTCGGAGCAGGTCAGCCTCCAACACGCAGCAGGGCCGCTCAAGAAACGACAAGAACAAAGAAGGAGGGGGGCCCCGGGA
CAGGACGAAGGAAGACGATGTTGAAGTGGCGGAAAAAGAGACGCGACAAAAAGAGGCAAATCGAACGATGTGGGAAACGG
AAAGGGGGCAGATGGCACAGACACAAGTGGCGGCTGCTGGAGCAAAGGCAGTACCACAGGCAAGGAATGCCAGTGTATCA
CACCGGCACGAACAAGCACCCAGACAGGCCTCGCAAGCTCGCGATACCTTCATTAAGGCCGATGAACCGGATCAATGGGG
CATGCGTGGTGTGCCACGTGCACGACAGGATCGCGAAGAACGGGACCTGATCGGAGGGATGGATGTGCACCTGACACATG
CGCAGGAGTATCAGGAGCACCAGGCACCGCCGACAGCACCCAGATCGGTGCTGTGGCCGGTTTATGTGGACGAGCGAGGA
AACGAGGTGGCTCGCTTTGAGCCCCCATCCAGAGAGGCGGGGCAACGGTCCAGATCGCCTCCCTATGTGCGGTATGCGGC
CGCAGTGCCATACCGCAGTCGAAGTCCGCTGGCACGTCGCTATGCAGGCGAAGCCGTGTACGAGACGCGAGCAGACAACG
GCATGGTCATGTACGAGAGGTATGCAGCTCAGGCATCGCCGGTCTATGCGCATCCGCACCAGCAGCAAGTGCCTCTGCGG
CAGCCGGGATACTACCGAGTATACGTGGACGAGGGGCAGATGGAACGACCGGTGGAATACGAGATTGTCCGCGTGAGGCG
GCCAGACAACAGCGAATATCATGTTCGCCTGCCGGTGCGCAGAGAGTTTGCAGAGCCGGGCGGCACACGGTACTATTCTG
GTGATGGTGGCCCAGAAATGGCAGCGGCAGCAGGAGTGGATGCGGCATACTACGAGGAATACGACCCGCGATATCCGGCA
GCAGCCCCATCATCAGCACCAGCAGGGCCCGGAGGCAGACGACAGGTGAGGTTTCACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62