GenePrediction:GLEAN_3706 Details

Name: GLEAN_3706
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:425702..426175 (+ strand)
Length: 474
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:425702..425754 (+ strand)
Length: 53
Type: CDS
Source: GLEAN
Position: GCSC_113:425822..425841 (+ strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_113:425907..426021 (+ strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_113:426079..426175 (+ strand)
Length: 97
>GLEAN_3706 class=GenePrediction position=GCSC_113:425702..426175 (+ strand)
ATGAGCGCTTTCGGGGGGCCGGGTGGTGGACTCGCAACGCAAAAGCCAATCCCGTAAGTGATGCTGCTAGCTGCCAGTGG
GATGGTGGAGGCTGACAGCAGACAGTCCTCAGCGAGGCAGCTTTCCGCTGGACCATGAAGGTGAGTGAATGGGTGAGAGG
CCGAACCGAAAGACGTCCGACAGCAGACATGCCCTGACAGCCCAGGCGAATGCAAAAAGGTCATGATGGACTACCTCGGC
TGCATCAAAAAGGTCAAGGGCATGAACGACAACGAGTGCCGCAACATTGCAAAGTCCTATTTGTCCTGCCGAATGGACAG
GTGAGTCGCCGGACAGATGTCATCGGTGCTGTGGTGCGTCTGGCTGACATGGAGCAGGAATCTCATGGCGAGGGACGAGT
TCAAGAATCTGGGCTTCAAAGATGACACCGAGACCAAGGAGGTCGAAAAGAGGCCAGGAGAGCTGCGATGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62