GenePrediction:GLEAN_3707 Details

Name: GLEAN_3707
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:426398..428568 (+ strand)
Length: 2171
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:426398..427197 (+ strand)
Length: 800
Type: CDS
Source: GLEAN
Position: GCSC_113:427245..428568 (+ strand)
Length: 1324
>GLEAN_3707 class=GenePrediction position=GCSC_113:426398..428568 (+ strand)
ATGCAGACACGTTGCCGCCAGCTGCTGTCTGCCGGGCGGAAGCGCCTCAGCAGCACCGCTGCCTCCTCTCCCTCACCGTC
GCCCTACGATGCCACGCTCGACCACCTGCGTATCGGCCGTCATACGCGCGTCATCTTCCAGGGCTTCACAGGCCGCCAGG
CCACGGCAAATGCGCGCGAGTCGCTAGCCTGGGGCACCAATGTCGTCGGCGGCGTCACGCCGGGCCGCTCCGGCGAGCAT
CTTGGCCTGCCACTGCTGCCCAGCGTGGCCGCTGCCGTGACAGCGCTGCGACCACACGCCACCGGCATCTATGTGCCGGC
TGCGCTGGCACCGGCTGCCATTGAGGAGGCCATTGCTGCCGAGGTGCCGCTGGTTGTCGCCGTGGCTGAACACATTCCGC
TACACGCAATGCTGCGCATCTCTGCCGTCCTGCGCACCCAAACGGCGTCAAGGCTCGTCGGCGCCAACTCGCCCGGTATC
ATTGCCGCTGTCGGCCGCTGTCGTATCGGCTTCCAGCCGCTCTCCTGCTTTGAGGCCGGCCGCGTCGGCATCGCTGCTCG
CTCTGGCACCCTTAGCTATGAGGCTGTCGCCTCCACCACGCGTGCTGGTCTTGGCCAGAGCCTCTGCATCGGTGTCGGCG
GTGATGTTGTGCCCGGCACCGACCTGCGAGAAGCTCTCACCATCCTCGCCACTGATCCCGACACTGATGCTATTGCCCTC
ATCGGCGAGATCGGTGGCACCAGTGAGCTCGAAGCTGCCGCCTGGATCCGCGAATATCACATCCGCGAGCCGAATCCAAA
GTAAGTTCTCTAGGCGTCTCGTTCCCTTCTCTCTGCTGACCTCTGAGACCTATTGTTGCCCTTGTTGCTGGCACCAACTG
CGTGCCCGGTCGTATGATGGGCCATGCTGGTGCCTTTTCGCTCCCCGGCGAGCCTGACGCCCATGAAAAGATCCGTGCCC
TGCAGATAGCTGGTGCCACCATCGTCGATCACCCAGAGAAGTTTGGCGAAGCTATCAAGGCACGGCTGCAGGAGATTGTC
AACAGCAGCAGCAGCAGCAGCGCAAGCAGTCTCTTTGGGCAACGGAGCACCACGCAGCACCGGGGATTGCACACGGCTGC
TCGAGGACGGAGATTGGGCGATGACCAGAAGAGGGTGTCACTCGGCCGCACTGCTTCCGTTGGTACCCAGCAGAGACGCT
CCATCTATCTGGCACAGGACGCATCATTCGACCTGCTGCGGAAGCACGGCGTCAATGCAGCTGAGTACTCGGGTCACGGC
GTGCGTCGCTACCTAGCCATCACCGTCGATCGCTCGGCCAGGTCGCCGTGTGTGCTAGCTGCACCAGACTTCGACTGTGA
CAGAAGTACCGTTGCACTGAAGCGTTTCCCATTTGCGTACGGTCCGTCTGGCATCGACGGTCTGCTGGTCGAGCGCGTGG
CCGCCCACCTGGGGCTGAGTCTGCACGCAGGCAGTGTCGAGGCGCTGCGCGACCTGCTGCGGGCGCTGTACGATGTCTTT
GTCGGCCAGGAGGCCTTTCTGGTTGAGACGGCTGTGGTGCAGCGCCTGGCCCAGCTCAAGGTCGTGGGAGCGCGGCTGGG
TCTCGACGATGCTGGTGTGGGTGCACGCGAAGCAACAGCCACGACGACGATAGCTGAGCCTGACGAGGCCGCGGCCAAGG
AAAACGGCATCGTGTACATCAAGCTCGGACAGTCGGACGCGGCCGAGCCCGCCCACATTGCGACGCTCGTCAACGGCGCC
GGTCTTGCCATGAACACGGTCGACGCGCTGGCCGGCCTCGGTGGACGTGCCACCAACTTTCTCGATACTGGCGGCAAGGC
CACGAGCGAGACGGTGCGTGTCTGCTTCGACGTGCTGCTGCGCGACCCGCGCGTACGCGTCATCCTCGTCAACGTCTTTG
GCGGCCTCACCCTTGGCGACATGATTGCCCGCGGCGTCCTGCTAGCCTTCCGCGAGACCTGTGTGACTGTGCCCGTGGTC
GTCCGCATCCGTGGCACCAACGAGGCTGAAGGCCAGTGCATCATCCGCGAGAGCGGCCTGCCGTTGTTTGCCTTTGACAG
CTTCCAGGAGGCGGCCGCCAAGGCCGTCGAGCTGGCGGGGACAACAGATGGGAAGAAAAATGATAAGAGGTTGAATGAAG
CTGGAGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62