GenePrediction:GLEAN_3708 Details

Name: GLEAN_3708
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:431363..434652 (+ strand)
Length: 3290
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:431363..431447 (+ strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_113:431554..434526 (+ strand)
Length: 2973
Type: CDS
Source: GLEAN
Position: GCSC_113:434609..434652 (+ strand)
Length: 44
>GLEAN_3708 class=GenePrediction position=GCSC_113:431363..434652 (+ strand)
ATGTCCATCCGAGCGAAGCCGCGGGAGCGGTCTTCCCGCAAAATGACGCCACCGTCGGCCAGCTACATGTCCGACGACCA
GTTCTGTGAGCAGAGCCCGACGCCTTGGTTGGAAGACGATGGATCGCCTGAGACGGGACCAGCACCCGGACCAACCCCTG
CTAACCCGACCACAGCCTCCTATCTATCCAGTCTGCGCAACAGCCGCGTTGTCCGGCCGGGCGGAGCTCGACCGCTTCCG
TCCAAGCTGTGTGGCCTCTCGCCGGCTCGCTGATCGTCAAGCCGCCAGCGGCACGCTGCCACGCACGTCCAGCGACCTGT
CGGATGTGTCGGTGGTCGGCAGCCTGACCTCCCGCTACTCGACCATCAGTGGCCGGGGCCGCGACTACTACCCCGAGAAG
AAGACGTCGTCTCTTCGCACCCTGCCACCACCACTGCGTCCCGACGAGGTCGTGCCGACTGACACGTACATTGAGCGTGG
TCAGCGCTGGATGGAGAAGGAGGAGGCCGTGTCTCTGCGACATGCCCTCGAAGATATGGACCTCAAAGGCAACAGCAGCA
GCAGTAGTAGCAGCAGCAACAGCAGCAACAGCAACACTGCTACAGGCACAACACGACCACTCTCGACCGTCACGACAAAG
GCCCTTGTGCCTGCACCGGCTGCCGACGGCACGACGCCCGAAGACGCCGACGAACACCGGATCTACCATGCCGCGCTGGA
CGAGGCGGCTGAGCTCGTGTGGCAGCACCAGAACGGCGTCAAGCCGCCCGAACCCGGGACGCCCTACTCGTACAAGCAGC
ATCTGCGCAAGAACAGCTACGCCTATGCCCGCACAGCCAGCGTCGGTCGGTATGGCGACGACATTGAGCCGACCGGCCTG
GCGCGCGACCCGGCTGCTCGCTCAGTCTCGGACAGCTCAGCGTCGTCTGTGGAGGGCAACGGATTCACGTCGTCGCACAG
CCGCTATTCGCTCAGCAGCAGCACTCGTCCGAGCCTCGACCAGCCGGCTGCCGTTCCCGAGGCCACAACCACAGCCACAG
CCACAGCCACAGCGACGATCCGATCTTCGGCGTACACGAGTCTGACGGGCGGACCAAGACCGATGGCAAAGAGCAGCAGT
GCGGCCAAGCGACGGAGCAGCATGAAGCGCAACATCAGCGGCGAGGTCGAGAAGCCGTTCTCGGGCGACCAGATCTACGA
GGAGCCCGAGACGGCGACAGAGAAGGACGGAGACGGCAGCGGCGACAAGACGGCCGAGAGCAGTGGCAGCAGCAGCAAAA
GCAGCAACAGCATTCTGCGGGCGGCCGTCGAGAACACGGTGCACGGCAGCAGCAACACGTTGGCGGCGGTGTCGAAGCTG
GTGTCGCGCTATGAGATCCACCGCAACCCGCCGTCACAGTCGCGCAACCCGCAATACACAACCAACGCGGTGTCTAAGCC
GGTGGTCACGGTGCAGCCGCAGGCGAAGCAGCAGCCGCCGAGTGAGCCAGGACGGGCCAAGGCATCACGGCAGAGGCTGC
AGGCGAGCGTGGTGTCGGACGACGAGGACTCGACGGACTCGGCAGCGGGCGTGGTGGACGGCGTGCCGCGTCTGAACGGC
GTGGAGATCCGCAGCGATGAGATCCGACAGGCCACCAGCATGAAGTTGAAGGACCGCAACCCGAAGCTGCCGACGCCGTC
GTTTGTCAGCGACAATCCGGGTCGCCCGATCGTAAGCTTTGACGCCAACTGGAAACAGGAAGCCCCCCCCGTCGTCGCGG
GCCAAGAGTCGGCCACTGATGCGCAGCTAGAAGGCAGTGGAAGCGGGAGCAGAGCGCGATTCGGCAGCAGCAGCAACAAC
AGCAGCAGCACCGCCACACCAGAGCCACGTCCCAAAGGCTCGCCCTCGCCCTTCTCGTCTGCCGTCCGCGGTCGCTTCTC
GACAGCCCCGTCGGTCCCTGTTGTCGCGCCTGTGGCGAGCTCTTGGTCAACGCCGCCATCACGGCAGCAGCAGTCACCAA
CACGCCGCGAAGGCGCTATGAGCGACAGCAGTAAACCAATTCACAGCCGCAACGACAGCAACCCACTACCCACCATCGCT
GTCACCCCTTCGGAACCGCCGCGACCATCACACCGAATGTCCATGTCGATTCCCTCGATCTCGGTCTCGGCAGAGCCATC
ATCTTCTTCACGCCCTCCGATCCCGACGATTGTGCTACCCGGAGACGACGCCGACGAGTCGAAGGTGTCCGACGACAACA
GCACAGCACGACAGCAGGGCAGGAGCCGTCCGCTTCCGAGCATTCTGACGCCCGACCAGACCCGAACCTCGGCCACACCG
ACGACAGCGTCGCGACGACCCTTGCCCACGCCTGGCAGCAGCAGCTGGCCGCGGGGACACTGGTCACGGGCGCCGCCGTC
CGGGTCGAGCGCGTCGAACACGTCGCACGCGTCAGCAAGCCGGGCCACGGCGCTGTGCCATGAGTGTGGCTACGCGATCG
AGGGCCGGTTTGTGGCGCTGGCCGGACAGCGACAGACTGGCTCGACGGGCTCGACGAGTGCGAGTGCGACGGGCTCGACG
GCAGCAGCGGCAGGTCTGGAGCGATTTCACCCGGGCTGCTTCCGCTGTCATGCATGCGGGACGTCGCTAGAGGCGCTAGA
GATCTCGCCAGAGCCAGACAAGTCACGTGCAGCACGGCTAGACCGAATCGCACGTCGGGCACATGGCGAGCAGCTGGAGG
AGCGGCCGGGCGAGACGATGGCCGAGGACGGCGACGGGCGGCTGCGCTTCTTCTGCCACCTGGACTGGCACGAGCTGTAC
GCGCCGCGCTGCCACCACTGCACGACGCCGATCGTGGGCGAGCACGTGGTGGCGCTGGGGCATCACTGGCATGTCGGGCA
CTTTTTCTGCGCCGAGTGCGGCGATCCGTTTGGGCCCGGGGCTACCCACATTGAGAAGGACGGCTACGCCTGGTGCGTGG
GCTGCCAGACGCGGCGGACGGAGCGGCGGGCGCCACGCTGTCGGGCCTGTGGCAAGCCGGCCATTGGGGCGTATGTGCAG
GCGCTGGGCGCCGAGTGGCACGACGACTGCTTCCGCTGCGCCGTCTGCGAGGGCGGCTTTGTCGACGGGCAGATCTTTCC
GCGGCAGGGCAAGGGAGGCCTGATGCAGGTCGTCTGCACCGGATGTCGACAGCGGGAATTGAAAGCAGTGGAGGGGGGGG
GAAGAAGTGTGACTGACGGAAAGGAAAAGGATAGAAGGAATTACAGACAAAGGTCGCATCGGCATCGGACAGACAGACGG
ACAAGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62