GenePrediction:GLEAN_3709 Details

Name: GLEAN_3709
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:436318..436726 (+ strand)
Length: 409
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:436318..436456 (+ strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_113:436560..436726 (+ strand)
Length: 167
>GLEAN_3709 class=GenePrediction position=GCSC_113:436318..436726 (+ strand)
ATGGCAAGACCTACGCCGCAGCCTAGTCCTCTTGAAACGACAACTGACGTTCTGGCCAGTCATCCAAGCTCGAGCAAGAC
CTCGCTACGCAGCCGCCGTGCCATCCGCGTGCCGTGCGTTGCTGCTCTCCGCTTCTCTTGTCTCTCCTGTAACTGACCCG
TGACTCCGTTCACAGTGTGCTATACAAGGTGGGCAGCAAGCTCTTACGAGTACTCGTAGGCAGTCCCTACTGACCCACAC
AGATTGCCTCGCCAAAAATGGCTACAACCAGGATCGCTGTCAGCGCCTAGTCGACGCTCTTTACGACTGCTGCGATGCGT
TTTATGCTCGTCAGGGCGACACTGCCTCTACGCCTAGCTGTCCCAGACCTGACCTGCTGCGGCTCAAGCTCAGCCAGCGG
AAGACTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62