GenePrediction:GLEAN_370 Details

Name: GLEAN_370
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1347373..1350336 (+ strand)
Length: 2964
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1347373..1347377 (+ strand)
Length: 5
Type: CDS
Source: GLEAN
Position: GCSC_167:1347512..1349585 (+ strand)
Length: 2074
Type: CDS
Source: GLEAN
Position: GCSC_167:1349654..1350246 (+ strand)
Length: 593
Type: CDS
Source: GLEAN
Position: GCSC_167:1350327..1350336 (+ strand)
Length: 10
>GLEAN_370 class=GenePrediction position=GCSC_167:1347373..1350336 (+ strand)
ATGTCGTAAGTGAGATCGGATACCGATGTGGCAATCTACACTTTGTAGCGGGGGAACCATGTGGGAACAAAACTGGGCAG
AGAGCCACATTCTCTTTTTTTTTTTTTTTTCGAACGCAGCGCTGACAGTCCTCCAGCAGACGTCGAACACGCTTTTCCGA
CCAGCCTTCCACCGGCTCCTCGCAATCCTACGACGGCGAAGACTCGTCCTCCCGCAGCCCAGACTACAGCGACGAAGACG
ACATAAACGGCACCTTCAACGACGAATACGACGCGGCCGCACCCTCTGCCGCTACTTCGGCCAGCTACCACCAGCAAGAC
CGGTACCAGAAACCATCTCCTCGAGGCAGCGTCCGCTCGCATAGCCGATACGAACATCAGCGAGTCTCTGGGTACCACGC
ACCCTCTGTGCCAACCGGAACAATGAGCGACCCATCGGACGACTATCCGCAGTACATGCACCGCACCGGCTACAGTGCGC
CGCCGGCAAACAGCTACTACCCGCAGCATGGCGCACAGAGCGCCGCATATGCTCCCAGCCACGGCGGCTACGGCCACTAC
GGTGGTCGGGGCGGCCAGATGGTCCCCATGCACCAATACAATCCGTTTGCGCCGCACATGGGTGGCAACATGGGTAGTAA
CATGGGGGGCTCGATGGGGGGAAATATGGGAGCCGTGATGGGGGGCGGTATGGGGGCCGCTATGAGGGGTGCCATGGGTG
CCAGCTCTGCCCTAAACTACTACAGCGACCCGCGTACGTCCAATCACGACATGATCCCATTCCAGCAGCAACAGGGCTTT
TACGGAGGCGGTCCCGGCTATGGCCTTCCGATGCAACCCTACATGTTCGGAAATCAGCACCCACCCCCACCCGAAGTACC
GGCTGCTACTACCCCAGCTCTGCCAGAAGAGAAGAAGCCCGACCCGGAAGTGGAGCGGATAAAGGAGCAGTTGAAGCAGC
TGCAGGCGGAGAAGGAAGCCAAGGAAGAAGCCGCTCGGCGTCAGCAGATGGAGGACGCCATCCGGCAGACCGCACAGGCC
GAATTTGCACGGCAACTAGAGGCCTCGAACAAGGAGCGTGAGGAGCAGGCCAAGGAGCTCGAACGGGCGAAGAAAGAAGC
AGACCGCCTGGCGCGTGAACGGATGGAAGCCGAGAAAAGGGCGGATGAGGAGAAGCGGATACAGCAAGCCGAATCGATAA
AACGCATCGAGATGGAGGCCCGGGCCAGAATGGAGGCCGAACGCCGAGCTGACGAGGAGCGCAGGAAGCGGGAGGCCGAG
GTGGCGGCACGGGTAGAACAAGAAGCCCGGTCCAAGATTGAAGCTGAACGTCGGGCGGAAGAAGAGCGGAGGAAGAGAGA
AGCAGAAGTGACGGCACGGGTGGAGCAGGAGGCTCGATCGAGAATAGAAGCCGAACGCCGTGCCGACGAAGAGCGAAGGA
AGAGGGAGGCCGAAGTAGCAGCACGGGTGGAGCAGGAAGCGCGAGCCAAGGTCGAGGCAGAACGCGTGGCCGAGTTGGAG
CGAAGGAAGAGAGAAGCAGAAATGACGGCACGGGTGGAGCAAGAGGCGCGATCCAGGATGGAGGCCGAACGCCGTGCCGA
CGAGGAGCGGAAGAAGAGAGAGGCCGAGGTAGCGGCACGGGTCGAACAGGAAGCACGGGCCAGAGTGGAAGCCGAGCGGC
GGGCTGAGGACGAGAGGCGGAAGCAAGAGGCTGAAGTGAAGGCACATCTCGAGCAGGAAGCCCGAGCCAAGATGGAAGCC
GAACGGCGGGCACAGGAGGAGCGGAAGATACGTGAGGCGGAAATCGCGGCGGCTGAGGCAGCAGCTCTGAAGGCGCGAGT
GGAAGCAGCGGAAGCGGCAGCCAAGGCCAAAGCAGCAGCCGACTTCAAGGCGGAACAGGAGGCCAAAGAGGCGGCGGAGA
AGAAGGCGGCGGAGGAGGCAGCATACCGGAAGAAACTCGAGGACGAGGCCAAGCTGAAGGCCGAGATGGAAGCTCTCAAG
AAGTTGGAGGAAGAGAAGAAGGCAGCCGAGGAAGCGCGGCTAGCAGAAGAGGCGAGGAAGAAGGCAGAGAAGGCGATGAA
GGAAAAGATGATGGAGGAGGCGAGGGCAAAGATGGAGGAAGCGGAAAAGAAAAAGGAGATGATGCCGGTCAAATTCAAGG
ATGCGCTTGGCCGCAAGTACAGCTTCCCGTTTCACTTGTGCAAGACCTGGCAGGTACGTCGCACCGTCTTTTTCTCTCCC
ACACACACATGGACGAAAGGGATGCTAACCTGATGCTGCAGGGCATGGAAGAGTTGATCAAGCAGGCCTTCATTCAGGTG
GAGTTCATCGGCCAGCATGTGCAGGAGGGACACTACGATCTGATCGGGCCGGACGGAGAGATCATCCTGCCGTCGATCTG
GGAGCGGGTGATCCAGCCGGACTGGGCTGTGACGATGCAGATCTGGCCAATGGACAAGATGCCGCCTCTTCGTCGGCCTG
GCGTGCCAGGTGCGGTGCCGCCTCCTGGAGTCCCCGGACATCCCGGACATCCCGGACATCCCGGACATCCCGGACACGGT
CAGGCTGCTGCACCGGCTAATGGTGTCCGATACCCGATGGCTGGCGGGATGGGGCGCGGCGTGCCCATGCCGTTCCGACC
GGGGATGGTTCCCGCCGGTGCCGCAGGTCCAGGCCGGGCTGCAGGGCCAGGGCCGGCACAACAGTGGCCCATGGGAGTCC
CTGGCCAGATGCCACAGGTTGTGCCGCAACCTGGGCAGCGGGCCCATGTTGTCAACGGTGATGGGTCCCGACACCACGAC
AAGAAGAAGTCGAGCTCCAAGACAGCGGGCACCCTGCTCGCATTCATGGGCGGCAAGCCGGTCAAGGTCAAGAAGTACGT
TTCCCGTTTCCCGATTTCCTTCTATGCAAGGCAGCAGCTCTAGACAGACCCGAACTAACGGATGGTGTCTCCAGGCGCAA
GTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62