GenePrediction:GLEAN_3711 Details

Name: GLEAN_3711
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:443275..447741 (+ strand)
Length: 4467
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:443275..443994 (+ strand)
Length: 720
Type: CDS
Source: GLEAN
Position: GCSC_113:444055..444911 (+ strand)
Length: 857
Type: CDS
Source: GLEAN
Position: GCSC_113:445009..445401 (+ strand)
Length: 393
Type: CDS
Source: GLEAN
Position: GCSC_113:445492..446667 (+ strand)
Length: 1176
Type: CDS
Source: GLEAN
Position: GCSC_113:446954..446973 (+ strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_113:447104..447741 (+ strand)
Length: 638
>GLEAN_3711 class=GenePrediction position=GCSC_113:443275..447741 (+ strand)
ATGGCGCCGACTCGATCCAAACCGAAACCGCACATGCAGAGCGCTGCGGCGCCGGCCTTCAACAAGGCTGCGCTGTCGCA
GCTGACGGCGAAGCTCGAAAAGGACCTGGAGAAGGCCAGCGTGCAGAACCTGCAGGGAGGGAAGCGGAAGCGCAGCACCG
ACGCCGTCGACGACGAGGCAGAGGCCGACAAGCACAAGGCCAGCAGAGCACCCAAGCGGCAGGCGGCCGCAGACGAGCCG
AAAGCGAGCACTGCCTCGGCCGCAACCAAAGAGACGGCCGACACCAATGCCAGCAAGAAGTCTGTCATGCTCGAGGAGAT
CAAGGCACTAGGAGGCGACGAGGGCGATCTTGAGCTCGTTGACGGCATCGACTCCGACGCCGAAGATGGGGCCGGCGGCG
GAAAGGCAGCCGATGCTGTCCTGTCTCTGGACGACTCGTTCAAGAATGAGCTGGCCAGCTTTGCAGCCAGCCTCGGCTTC
GACCAGGCGCGCGAGGACGACCTGGACGACGCGGCAGCAGAGGAGGAGCTTGTCACTGCCGACGCCGACAACGACAACGA
ACAAGAGGGAGAAGAGGAAGAAGAAGAAGATGAGGAGGAAGAACAGCCCGAACCAGCAGTAGAAAAGAAGGAGGAGATCA
TCACCCGGCAAGAGGTCCCGAAACCTGCGCCAGCAGCTTTGGAGTCGCTCATTCCGAGGAACCCCAAGTTCTCCAAATTG
GTTAGTCAGCAGTCTGCATCAACAATGGGAAATCAACTACTGACACGCAGCTCCATCTAGACGTTCGAGCCCCGTCCCGA
CTGGCACCAGGTCAGCCTGCCAGTGTTGCCGGCGCCGGTGTCGGACGACATCAGCCGGCTCTCGACCACGATTGCCAACC
TCAAGACGTACGGACAGACGCTGATGGAAGCCGATGGGGCGCTGTACCAGAAGATCGTGGCGTCGTCGTCGTCGCATCGC
TTCATGTCGACCATCATGTCATCGGGTACCATGTCCGACAAGGTCTCGGCCCTGACGCTCGAGGTGCAGGAAGCGCCCGT
GCACAACATCAAAGCCTTTGAGAGCCTGCTGGGCCTGGCGGCCAAGCGGAGCCGCGGCCAGGCGATTGCGGCCCTGGGCG
CCTTGGTCGATCTGCTGGGCAACGGCGTTGTGCTGCCGCCAGACCGCCGCCTGCGCGCCTTCCACGCGCAGCCGGGCCTC
GTCGGCGTCCTGCAGGCCGCTGAGAAGGTGGCCAAGGTTGAGCGCAGCCGCCAGTACCAGCGCAACCAACAGGACCTGCA
GAACCAGCGGAACCAGCGCTTCCAGCGGAACCCCAAGAACCAAAAGAACGCCAAGCCGCTGCCCGAAACTGCTGACGCCA
GCGCCGACCGCTGGGCTCCCGGCCAACGCCTACCCGACGGCATCACCAAGGCCCATCTCGTCCAGTGGGCCTACGAGGAC
TGGCTCAAGGATGCCTTCTTCCGCCTGCTGCAGGTGCTCGAGGTGTGGTGCGGCGACGAGATCGAGTACTCGCGCACCCG
TGCCCTCGACTTTGTCTTTGGTCTGCTGCGCGACAAGCCCGAGCAGGAGGCCAACCTGCTGCGTCTGCTGGTCAACAAGC
TGGGTGACCGCGAGCGCAAGATCGCCTCGCGCGCCTCGTATCTGCTGCTGCAGTTGCTGAACATTCCACCCCGCCATGAA
GCCTGTCGTCGTCGCTGCCATCGAACAAGAAGTCCTCTCGCGTCCCGGCCAGAGCCTGCGCGCCAAATACTACGCCATCA
ACACGCTCAACCAGACCATCCTCAGCACAAAGGAACCCACCGTCGCCGACAGCCTCGTCCGCGTCTACTTTGAGCTCTTC
CTCTCCCTGCTCAAGAGCGGCGCTCTCGGTGCCATCGACATGCCCGATGCCGCGGACGATATCGCCGCCAGCGGCTCCGC
CCCCAAAAAGAACGACAAGAGAGGCGGCAAGCGGGACGACCGCCGGCGAGACAAACCCAAGCCCGCCGACGACGACAAGG
ACAAGGATGCCAAGAAGGACAAGGAGAAGAACACTGGCAATGAGCGCGACGTCGCCGAGAAGCTCGTCTCTTCCCTGCTC
ACCGGCGTCAACCGGTCCATCCCCTTTGCCAGCGCGGATGATACAACGTAAGTCTTGCCTGTCTGCTTAGTCACGTTCCA
ATTTCGTGCACTACATGTGGTATCGACCGATTAGTCATCATTCACTAACACCCCCAGTCTTGAGAAGCACATCGACACGC
TCTTCCGCGTGACGCACTCGTCCAACTTCAACACGAGCATCCAGGCGCTCGTGCTGGTGCAGCAGGTGGCCGTGGCCAAG
CAGATTGCCGTCGACCGGTTCTACCGCACGCTGTACGAGTCGCTGCTGGATCCGCGCCTGGTCACGTCGTCCAAGCAGGC
CATGTACCTCAACCTGCTCTTCCGCGCGCTCAAGAATGACGTGGACGTGCGGCGGGTCAAGGCGTTTGTCAAGCGCATGC
TGCAGATCTCCACGCTGCACCAGCCGCCGTTTGTGTGCGGCATCTTGTTTTTGATTGTCGAGCTGGAGACGTCGTTCCCG
GACCTGAAGTCGCTGCTGAACAGCCCGGAGGAAAACGAGGAGGATGAGGAGGAAGTGTACCACGACGTCGTGATGACCGA
GGATGGCCGTGCGGCCGCAGCCGAGCAGCCCAGCTTCGAGCCGGCGGCCAAGATCGCGCGCGCCACGTACGACGGCCGCA
AGCGCGACCCCGAGTACAGCAACGCACAGAAGAGCTGTCTGTGGGAGCTGGTGCCGTACTTTCACCACTTCCACCCGTCC
GTCATGGCCTTTGCCACCAACCTACTCGTGCGCCAGACGTCGCTGCCGAAGCCCGACATGGCCAACCATACGCTCATGCA
CTTCCTCGACAAGTTTGTTTACCGCAACGCCAAGGCCACCGACGGCAAGCAGCACGGTGCCTCCATCATGCAGCCGCTCG
TTTCGGCCGGCGACGGCGCCACCACGTCGGCCAACGGCGCCTCACAGATCGTGGCCCCGGCAAAGGCCGCGTCCCAGCAG
CAGGCGCAGAAGCAGAAGCCGTCGACCTCGGTCAACTCGGCCGCCTTCTGGAACAAGAAGGTCGAGGACGTCGCCGCCGA
GGACATCTTCTTCCACGCGTACTTTTCCCAGGTCGGCAAGCCGGCACAGACCAGCCGGGCAGCCAAGCGCGACGCCCAGC
GGAAGGAGAAGGAGGCGGCCGAGGCAGCTGCAGCCGCTGGCTCGGACGCCGGCTCCGATGCCGACGAGGAGGAGATCTGG
AAGGCGCTCAAGGGATCGCGGCCCGAGGTCGATGCGGATACGGTTGTCGACATGGACGACCTGTCCGACGACGACGACGA
CGACATGTCTGGCCTGGAGGAGCTGCTCAACATGTCGGACAGTGACGATGATCTGGACGGCGACGACAGCGTCGACTTTG
GTGACGACGACGAGCTGGTGCAGGTCGGCGGCGATGATGATGACGACGAGGGCGGCGTCCGGTTTGCCGACTTTGACGAC
GAGGAGGCCGGATCGGAGAACGGCGAGGACGGCGGCGACCGGAACGGCCGCAAGGAGGCGCGCGAGCGCAAGAAGAAGCT
CAAGGCGCTACCGACGTTTGCGTCGGCCGACGACTATGCCGACATGCTGGCGCAAGAGGAGGACGAGGAGTATTTGTAGA
GGAGCACGGGAACACGGGAGTACGAATAAAAGAGAGCAGACTTATTTCACCTTGGGAACTGCTGAAATGTGACGTTGGAC
GTTTCTGTCATACTTTCGCTTCGCTTTTTCACTTCTTTCCCTTCCTTCCCTATGTTTCACACGCTTCAGAACCACTCGAG
TGCTTCGGTCGCCGGGAGGAGGGTCTGGTACGTGTGCAGGTGGCCGTCGCCTTCGTCGGTGGGCGTGTCAATCTCGCGCG
TGTAGAAGCTGTGGAAGCAGGCCTTCGAATTTGGTCCCTCGTCAAAGGCGCGGAAGTGCACGTAGGCCGGCGCGGCTTCG
TCGCCGCCGGCCGCCGCCACGAGCGCTGGGATGCGCAGCTTGCCAAACAGGATGATGCCGTAGGCCGTAGAGGCGACGCG
GACGAGCACCAAATCGTGAGACGTGAACGAGGCCAGCTCGTGATCCGACAGGCCGGATGCGGCAGCAAAGCTCTCTGGCT
GATGTTCTGGTCACTATCAGCAGATGTTGGCGCCTATACTTGTACGCGTACCCCTCTCCCACGTACTGTCGTGGTCGTGG
CGCAGATGCACGAGCTGCTTCCGGAGCTCGTGCTCAATCTCGCCAAACGCCTTGATGGACTCGTGCTTGGGCAAATGGGC
CTCGCCCAGATCGGCCGTCTCTCGGGTAGCCTGCAGCATCGGTCAGCAGTCGTGTATCCGGTCATGATGTTTCATCTCGC
CGTGCATACCATTGTCTGTGCTTTGTTGAGGAATTGGAATGCGATCAGGGCAGGGGTCAGGTTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62