GenePrediction:GLEAN_3712 Details

Name: GLEAN_3712
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:448237..449471 (+ strand)
Length: 1235
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:448237..448423 (+ strand)
Length: 187
Type: CDS
Source: GLEAN
Position: GCSC_113:448492..448847 (+ strand)
Length: 356
Type: CDS
Source: GLEAN
Position: GCSC_113:448997..449368 (+ strand)
Length: 372
Type: CDS
Source: GLEAN
Position: GCSC_113:449439..449471 (+ strand)
Length: 33
>GLEAN_3712 class=GenePrediction position=GCSC_113:448237..449471 (+ strand)
ATGTTCTTACAGCGGACTGCCGCGACGCCCCTGAGGCCGATGTTGAATACGCACTTCCGGATAGGCCTCCTCCAGTCATT
ACGGCAGCCAGAAAGACGCCACATCCACCACCTCCGGCCCGTCCGGCACGCAGTTGTCGCCGGTCAAACGTCTTTCTCTA
GTCGCGTCTTCTCCCCCAGCAGACGAGGTGAGTTTGTCGCTGTCGCTTCTCTGGTCAGTTGTCGTGGACTTACTGCTGAC
CGTGTTTCGTACCAGCCTTGTCATCCTCCCTCGCTTCCCCCTCTTACGACCCGCAACAGCAGCAACGACAGCACCAACAA
GCACCACCACCACCACCACCTCCACCATCGCGCTCCCGCTTCCGCCGTTTCGTCTCGCTCGTCATCCGCGGCTTCTTCTT
TACCACCGTTGGCTATGTGCTCGTCGTCGGTCACTCCACTCGGCCGCTGTGGAAAGACCTGGACGTGGCCTCGCTGTTCC
GGACCACCAACGATACCGACCCGCTCTCGACGAAGAGGCCGCTCTCTCGTGCCCATGCGGCCGAGCTGGCCTACCGGCCG
GACAGCCCGGAGGCTGCCGCCCTCGAGGCATACCTGGCGGACCACCCGATGGTGCGCGAGCTGCGCAGCGCCGCCGGACG
GACACGCTTCCCCGAAGAGCACCGGCCGACGCTGCGCATGCCCGCCTTTTCATGGGACGACACAACCTGACAGCGTCGAC
GCTGGCCGGGCCGGGCTTGCTGGCGATACCGCCGCTGCAGTGGACCGACGGCCATGGCCGCGAGCTGATCCAGGTCTGGC
ACCTTGGCCGCGGCCTCTGTGGTCATCCCGGCATCGTCCATGGCGGCTTCGTCGCCACCATGCTCGACGAAGGCCTCGCC
CGCTGCTGCTTCAACGCCCTGCCGATGGGTGTCGGCATGACCGCCTATCTCCATGTCGACTACCGTGCCCCCACGCCGGC
CGACGCCTTTGTCGTCCTGCACGCCAAGACTGTCCGTGTCGAGGGCCGCAAGGCTTGGGTTCAGGCCCGCCTCGAAACCC
TGCCGCCACCATCCGAGGACGGCAAGCCCGCGGCTACGCCCGTCGTCTTGGCCGAGGCTGAGGCCCTCTTTGTCGGCTTC
CGCGACAATGGCGTACGTCTGGCCCGTCTCTTGTTCCCCCACATGTGTTCCTCCTGCCTTGCTGACATGCATCTGTATCT
AGCTCGGCAAGTTCATGCGCTCCCTCAACACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62