GenePrediction:GLEAN_3713 Details

Name: GLEAN_3713
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:452749..454981 (+ strand)
Length: 2233
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:452749..453158 (+ strand)
Length: 410
Type: CDS
Source: GLEAN
Position: GCSC_113:453216..453607 (+ strand)
Length: 392
Type: CDS
Source: GLEAN
Position: GCSC_113:453816..454132 (+ strand)
Length: 317
Type: CDS
Source: GLEAN
Position: GCSC_113:454206..454229 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_113:454293..454583 (+ strand)
Length: 291
Type: CDS
Source: GLEAN
Position: GCSC_113:454772..454981 (+ strand)
Length: 210
>GLEAN_3713 class=GenePrediction position=GCSC_113:452749..454981 (+ strand)
ATGGCTTCATCTCAAGCATCTGGTGTCGATGCCTCTGGCTACACCGTCGAACTCACTGCTGGCAGTTCTACGATGCACGG
TTCTGCTACAACTATTGCAGCGAATCCTACCAGCGCCGCCAACACTCCACACGCTTCTGAGAGCTCCTCGGCGTCGGCAC
CAACACCATCGCCTAAACCACAGGATTCCCCCGAAATACTCGATTTGTTGAAAAAGTTCCAGGACTTCGACGACAAAGCT
GTATACGATCAAGTCAAATTGGAGTGTCAGAAAAAGGAGGCAATGAACTTCGTCGTACAATTTGGTGTCGATGAGGCCAA
GGTGGCTTGCAATCTTGACCACCGAGACTTTGATACTCTGATGAAGCAGCGCAACGTGTTTGGCGAAGGCAAACTGCCTG
TTCGGTGGATGTATGTCCCTCCTTGACTGCCCCATCTTCGCTTACTATACGCTAACTGTCTGTCTAGCAACATCTGGAAT
CCAAGCCGCCAGCGAAGTACCATCAAGGCCATAGGCAAACACTACAACTTCTCCAAGCGGCTGATATTGAGCATCTGGGC
CTGGGACGCAGTAAAGGAGGAACTGATTAAAAAAAAGCGCGAGGCTGCTGAAGCAGCATTATTAGCCAGAGACCCTGGCC
GGGTTTTTCGCTCGAAAGGAAATGCTCACCTCAACGATCTGGAAAATGGCGTGAATGGACGGCTTGATGCCGCTGCCTCC
TCTGTCTCCGTCTCCAGTGCCGGATCTAAGAATGAGGACAATTCGGATCTGGCAGGCATCTTTGATCCAAAAAGCATGGC
CACGTTCGCAATGATGCAGAAAACCATTGACTACACCTCAATCGACCTGGGCCCTCGATGTAAGTGAAGACGTCTCACGA
ACACCTCCCGCAACTACTGACCGTGGCATCAGTCATATGCTTCGGAGCCAACTGGCTACACGAGCCACCACGCAAGTCAA
CGACACTCGTGCCACCCAAGCACTGGTCTTGGTTTGCTCTGTGTGATGACTGTAGGTGCATCTTTGAGGATACGCTCTTA
TGACGTTCTGACGGCTAACGAAATTAGATACCGTCCTCTCATTTCACGAATCGTACTACGAGAGCTTTTCCCAGGAGGAA
GGCGAGAACAACCCTGACTGGGCCACGGAAGAGCTCAAAAGCACGAGGGACAATACGCTCAAGGTGTTCCGTCAGCTCTC
CAAGCAAGGCCAGGAAGAGGACAAACACAAAATCATGCAACTGACATCGGTGCGTGAGTCGATGAGCATGGCCCGTGACA
AGGAGGGCAAAGAAGGCGCTTGCAATATCTTCTACTATCTTTTCGAGGATTATTCTGGTGCGATGTTTATCCTGGGTAGT
ACCAAGGCCGCACTGGACGTTATTGTGAGTTCCCCTGTTCTGCGACGCTGCTTATATACTATACCATACGATTGCTAACA
AATTAACTAATTAACAGAGTAAACGAGTTCTGCGAACTGCTGTAAGTGGGAGTTGCTAGCTGCCAGCTGGGAGTCTTTGA
CTTGTTTTCTAACATCCGGCCTAGGAGTGGAGAAACAAAGATAACACAACCGACATCATTCCCAAGCTGTATAAGCTGAA
CAAGGAGCTTCGCGAGCTGCGCCATCTGTTCACCAACTACAATACGCTGATCAGCAAAATAATCAACAAAGATCTTGACG
AAGCCGCGGAAGCAGCGGCTCCAGGCCACCCTGTGGACACACTGCTGTCTTACAGCGCCCTGAATCGATTCAAACGACTT
CAGGTTCAACTGCAATCCCTCATGCTCGATACAATCAAGGACTATCTCGACGAAAAAGAGTCACTGCAAGACACTGTAAG
TTTGCATTTTCTAATCTTGAATATACATGTCTCAGCCGCACTAACAGTCTCTAGTACTTCAATCTCACGAATCAGAAAGA
CTCACAGGCGACAGAGCGACTAACACGGAGTGCCACTGTACTTGCCAAATTGAGCGTGTTTTTCCTCCCGATCTCCTTCA
TGACGAGCTATTTTTCTATCCAGATCCCAGATCTGACAGAGGGCTACACTAAGTGGTCGTACTGGGGCTCCTTTGCGGTG
ATAGCCGGCGTGTCATTTATGAGTCTCTTCTTCTTCAGCAAGGTGCTCATGTTCCTCAGCGATTGGCTGGACCACTTTGC
CGAGAGGGTCGAGGGGTGTTTCAAGAAACTTACGGGCTCAAAGACAGTTGACAAGGGTACCAAATACGAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62