GenePrediction:GLEAN_3714 Details

Name: GLEAN_3714
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:459217..460121 (+ strand)
Length: 905
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:459217..460034 (+ strand)
Length: 818
Type: CDS
Source: GLEAN
Position: GCSC_113:460103..460121 (+ strand)
Length: 19
>GLEAN_3714 class=GenePrediction position=GCSC_113:459217..460121 (+ strand)
ATGGTTTCCGGCACGTTCAAGCATGGTCCTGCTAATGGCTACAAGCACACGCACACTATCATTTTCCTACATGGTCGTGG
CAGTAACGCAGATGAGTTCGCTGGCGAGCTCTTCGAAAGCGAAGCCAGTGCAGATACTACTCAACCAGACCAGGACCTGA
CGATCCCGGCCATGTCTCCCAATATTCGATGGGTCTTTCCCCAGGCCCCAATTCTGCGTTCTGAACGTTTTGACACGGAA
ATGTCACAGTGGTTCGACATGTGGTCTGTCGAAAACCCCGAGGAGCAGAGCGAGCTTCAGCGTGATGGCCTAAAACAGAG
CATGAAGACAATTCTCGACACCGTCCACACTGAAGAAAAGATCTTACCTAGAGACCACATATTCTTAGCCGGTATTAGTC
AACGCTTTGCGACAGCCCTTGCCACGATGCTCGCCGAAGGACAAGGAGGTTTTTCTGGTGTTCTAGGATTGTCCAGCTGG
ATGCCATTTGCCAACAAGGCTGAGAAAGAAATAGCAAATTTCTCGCAAGAAAACGACGGCCAGCTCCGCTTATTCACCGC
ATTGCGGTCTCTCTACGGAAATGAGGACGTACAGGACGACGCGAAGCAAGCATCGCCCACCACGATAAAGGCAACCCCTA
TATTTCTAGCGCATGCGCTGGATGATAACGTTGTTCCTGTAGAGAACGGGGAACGTATGCAGCATATTCTGCGCGATGCC
GGTCTGACAGTTGAATGGCACAAGTATGCGGACGGAGGTCACTGGGTGAACGAGCCTGAAGGCGTTGATGACATTTTGCG
TTTCCTAAAGCGGTGTATGTAAGTCTTTATATAGAAGCCTAGTCGGACGTCGCTGCTGAAAGGGCTGTTCTTGAGGCGCC
GACCAGGTCCTTCTCGGACGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62