GenePrediction:GLEAN_3715 Details

Name: GLEAN_3715
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:464551..468121 (+ strand)
Length: 3571
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:464551..464603 (+ strand)
Length: 53
Type: CDS
Source: GLEAN
Position: GCSC_113:464778..465066 (+ strand)
Length: 289
Type: CDS
Source: GLEAN
Position: GCSC_113:465150..466884 (+ strand)
Length: 1735
Type: CDS
Source: GLEAN
Position: GCSC_113:467415..468121 (+ strand)
Length: 707
>GLEAN_3715 class=GenePrediction position=GCSC_113:464551..468121 (+ strand)
ATGTCGTCGTACTTTGAAGGCCTCAAGGCCAAGATCCAGGACGGCATGCTGATGTCCGTCGATTGCAAAAGATTTCTTCC
TACCAAAAAGCTTGACGAAATATTAACTTCCCTTGAAATAAAAAAAGCCGTCGAAGAACTCGGATGCGATATACAGGAAG
GCTTAGGGCTGATTGAAGACATACAGAACCATGGGAAACGAATGTTTTCCATGCTTGTCTACAATAGTAAACAGGAGCAC
ATTGCCTATTTATGCAAGAATCGCTTTCTCGACGATAAGCTCCCGTTCAGTGTAGCCGATGCAACTAAAATGCTTATACC
TGAAGGCCAACGATTTGCCGAATCTCTTCAATGGGAGTTTTGCCCGTACGTCTTTCCGAAGAATAAACACAACTATCAGT
TGGATCAGCAGAGAATCCTTCCATTCATCCACTGCCAAAAGGTCGGAGAGGGGGCATCGGGAGAAGTCGAAAAGGTCGTC
ATCGCAGCGTCGCACTACGAATTTTCCAGTGAAAACGTAAGGAAAGAAATATCTTCTTTGCAATCGCCCGACATTGCTAC
GGGTACTTTAGGTTAACTCTTTTCTAATACATATTTTAGGACGGAGAGCTAGAGGTGGTGCGAAAACGCTTTCGAGTTCG
TGGTAGCAAGGATGTTTCTGAAAGAGAGTACAAGTGCTTGCGACTCTTGGACAAACTGGGGCATCCCAACATCATTCCTC
TGTTTGGATCCTACACATATGACGAAAACCGGTATCTCCTTCTCAAAGCCTTCGACAGAGACCTCGAAGACTTTCTTGAA
GACGACACCCGTCACAAAGACTTTCAACAGGACTTGACCTTCTACTCGGCCCTTACAGGTCTCGCCTCAGCACTGTCGAA
GACGCACAATTTCATGCTCACCAATGACGAACATAAAGTAGACTTTGAGGCTATTGGATACCATCACGACTTGAAGCCGC
GCAATATTATGGTTTCTCACGACAGCTTTATTCTGGCCGACTTTGGCGAAGGCAACATCAAGTCGGCGCAGGAATCATCG
CATACGCGATACAAGGAGATTGTCGGGAGCTACATTGCCCCGGAGTGTACCGACGAGGAGGAAAACCCGCAAACAATCAA
CCGGGCCGTTGATGTCTGGGCTTTGGGCTGCATCATTGCCGAGGTGGTCACCTATATGGAGAAAGGGACACGAGGTGTCC
GGCAGTTCCGCAAACAGCGGAGACTTCCAGGGCGGCTCCATAGATTCGAAGACGATGGTTTCTACAGTTCCGACGGTGAA
GTGAAAGAAGCGGTCCTCGAGTGGCTCAAGACACTGAGAAGTAACGCCAATGCCGACCTGGTCGAGCTCATTAACCTGTC
TCTTAAGGCTCTGAGCCGAATACCGTCAGATCGGCCTTTGATGCACGAATTGCATCAGAGCTTGGCTGATTTGAGTCTGC
GAAAGTACTTGAGCACTACGGAAGAATTGCTTGTCAATGTCTGCAGGGATGGAGCCTCGCATGGGACAGACTCTATTCTG
AAAGATTTCCGACGTGCATGCGATCTGCTCAAGCAATGGGAAGAACTGTTTTCTTCGAATATAAATATATTTTACGAAGA
CCCGAAAAATCTACCAGAGGAAGCTATTAGGATCCTGAAGAATCTGCTCCAGGTGTTGGAAGAGGAGAAGAAGGAAAGTC
GGCTATCAGACAATGAAAATTTTCAGAGGGCCGACCTCGCATGCTCAGCGTTAGGACGAGTTTACGAGTTGTGGGAGCTC
TTAGCCAAGCTCCCAGAAGCTCAAGGCATTCTGAGTCAACGTCGCGAAGCAGACGGAAATTTACCCAAAGTGTCCTTAAC
CACACCCGTCAACATCCTCTTGCCCGATTTCAAGAAGGCGGCGAGAAAGTTCAGAGACGGCCTTCCTGCCTCCGTGTCTC
TTGATGAAATCGACAAAGTCGCTTCGATCGATGCCGTGTACGACATTGTGGAAAAGATACAGGAAAAGCAGCAAGAACGT
AACGGGCTTCGCAATCTGGCGAGGATCCAGCCATATCTGCATCGTCTAGAGGGCTTTGCAGATACCATTCAGAAGCATGT
CATTGGTGAGAGTCCCGGTATTCCAGCGCTCCTTTGGGGCCCAATCGCACTTCTTCTGCAACTGGCGGTCAGCTCGAACG
TGGCGTTTGATTCAATCGTGGAGGCCACTGCTATGGTGGGGGAAGTGCTGCCTGATTATCCAGCTTTGGATGCTATATTT
CAAGAGAGCATGGAAGCAAAAGAAATTCTGCTCTTATATTTTCAGGACATCATGATGTTCTATGCTGAAGCTTTCCAGCC
CTTCAAAAACATCGGTATGTTTCTGTCTCTATGGCTGATTGTGAGTCACGTCCGTATTAGGTTTCTAACAATTTAAAAAG
ACAGCATACACGTGTTTGATAAACTGTGGCCAAAGTATCGGGACAACATTGAGCAGGTTACAGATTATACGCAGCAGCTT
GCTCGACTTCTGAGAACCAGTGTGAAGCCTGAACACATTCAGGAGCAACACGAGCTTCGAAAAACCAAACTTCAAAAGGT
TAAAAACAAACATCGGGATGGTATTCGCCAAGAGTTTGACCGCATCAGGACATCTTTCAAGCTTCCCGAACACGATCTAG
TCCTGGCCAAAATAAAGAGTAATCCTTCGAGAGCAGCTAGCACCTGGTTTTTTCAGCCGAATGGAATATTCATGAAGTGG
TTCCACAATTCAAAAGATGATGATCGAATACTTTGGCTGAGAGGGATTCCAGGTTCAGGTAATTCCACAACCTTCACTGC
ACGACGATGTGCGCCAATCTTGGACATAAACACTGCTAACTTTTGGTCGTTTTTATCATTACAGGAAAAAGCTTTCTTTC
CGGCGAGATCCTTCAACGATTTTATGGCGCCACAAAGACAGCAACAGCCTTTTCATTCCTGTCGTACCAGGTTGCTAAAG
ATGCTGAAAGTCATGATTCGGCCAAATTGGAACGCGTGGCCTTGACAACAATTCATTCCCTTATCATCCAGATGGCTAAG
GAATCCGAAGATCTCATGGAAATTGTCTGCGGTTCGAACATGACACAAATAAATTCGGATATTGCAGCCGCGGGTGATCT
TCTTGCCTCGATTGTTCGACATGCTGGCTCTACACTTCTCATAATCGACGGCCTTGATGAGATCAGTGAAGCCCAGCGCG
GCAGCCTCGTCGTGGAGCTTCTCAGGCTTGCAAGCTCTTGTAACAGGCTAAAACTTGTCGTGAGCAGCCGGCCCGAAGCC
GATCTAACAAGGCATCTGCACAATGTGGCAACGACAGTCAAAGTTCATGAGAATAACAAGGAAAGCATCAGTAACTACGT
CAAAACACGCGCCGAACGTATAATCAAGTCCTACAGCTACTACCCGGGAGAAGAAGAGCAGATCAGAGACCTTTTTCCGG
TGGTGGCAGAGCGTGCGAAGGGCATGTTCCTCTATGCCCAGCTCATCATGGATATGGTCAGCAATATGGAAACTTTGCCA
GAAATACGGGATGAGCTGACAGTTCCCCCAGAAGACCTTGATGCCACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62