GenePrediction:GLEAN_3716 Details

Name: GLEAN_3716
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:478909..480473 (+ strand)
Length: 1565
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:478909..479032 (+ strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_113:479094..479347 (+ strand)
Length: 254
Type: CDS
Source: GLEAN
Position: GCSC_113:479406..479497 (+ strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_113:479573..479623 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_113:479678..480473 (+ strand)
Length: 796
>GLEAN_3716 class=GenePrediction position=GCSC_113:478909..480473 (+ strand)
ATGGCTATTACCAAGATCCACGCCCGCTCCGTCTACGACTCGCGCGGCAACCCGACCGTCGAGGTCGATGTTGTCACCGA
GACGGGCCTGCACCGCGCCATGGTGCCCTCGGGCGCCTCGACCGGTTCGTCGACTCCTTCTATCCTCACGGCTGGACTGG
CAAGCTAACAGACCGTCTCTCTCAGGTCAGCACGAGGCTTGCGAGCTTCGCGATGGTGACAAGTCCAAGTGGGGTGGCAA
GGGTGTCCTCACGGCCGTCAAGAACGTGAACGAGACCATTGGCCCCGCCGTCATCGCCGCGAACTTTGATGTCAAGGACC
AGTCCAAGGTCGACAAGTTCCTTGTCGAGCTTGACGGCACCCCGAACAAGACCAAGCTCGGTGCCAACGCCATCCTCGGT
GTCAGCTTGGCCATTGCCAAGGCCGGCGCTGCTGAGAAGGTGAGCAGAGGTCAAGGTTGATTTCAAAAGTGGATACGTGC
TGACAATTCGTTTCCAGGGCATCCCCCTGTACGCCCACGTGTCCGACCTGGCCGGCACCAAGAAGCCCTACGTTCTCCCG
GTTCCGTTCATGAACGTCCTCAACGGCGGGTATGTTTGGCAAGAGAAGAAGAAGAAGAAGAAAGACGAAGAAAAGGCTGC
AGGAAAATGCTGACTGTCATACAGTTCTCACGCCGGTGGCCGCCTGGCTTTCCAGGAGTTCATGATTGCTCCGTCGTAAG
TATCCCCTGGCTATCCAGAGGCTGTACGTGTCGGTTTCTAACAGTGCAGTGATGCCCCGTCCTTCTCTGAGGCTCTCCGC
TGGGGTTCGGAGGTGTACCACCAGCTCAAGAGCCTGGCGACGAAGAAATATGGCCCGTCTGCGGCCAACGTCGGTGACGA
GGGTGGTGTCGCTCCGGATATCCACACGGCAGAGGAGGCGCTCAGCCTGATTGCTGAGGCCATCGAGAAGGCCGGCTACA
CCGGTCGGATGAACATCGCGATGGACGTTGCATCCAGCGAGTTCTACAAGGTGGACGCCAAGAAGTACGACCTGGACTTC
AAGAACCCGGACAGCGACCCGACCAAGTGGATCACGTACGAGGAGCTGGCGGCCATCTACGCAGACCTGGCCAAGAAGTA
CCCAATTGTCAGTATTGAGGACCCGTTCGCCGAGGACGACTGGGAGGCGTGGAGCTACTTCTACAAGACGCAGGACATCC
AAATTGTCGGCGACGACCTGACGGTGACGAACCCGCTGCGCATCAAGAAGGCCATTGAGCTGAAGGCGTGCAACGCGCTT
CTGCTGAAGGTGAACCAGATCGGCACTCTGACGGAGTCGATCCAGGCGGCCAAGGACTCGTACGCCGACGGCTGGGGAGT
CATGGTGTCTCACCGGTCAGGCGAGACGGAGGACGTGACGATTGCCGACATTGTTGTGGGTATCCGCGCCGGTGAGATCA
AGACGGGTGCGCCGGCACGGTCGGAGCGTCTGGCCAAGCTGAACCAGCTGCTGCGCATCGAGGAGGAGCTCGGCGACGCG
GCTGTGTACGCCGGCACCAGCTTCCGCACGGCTGTCAACATTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62