GenePrediction:GLEAN_3717 Details

Name: GLEAN_3717
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:480843..484830 (+ strand)
Length: 3988
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:480843..481583 (+ strand)
Length: 741
Type: CDS
Source: GLEAN
Position: GCSC_113:481833..481964 (+ strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_113:482135..482456 (+ strand)
Length: 322
Type: CDS
Source: GLEAN
Position: GCSC_113:482534..484830 (+ strand)
Length: 2297
>GLEAN_3717 class=GenePrediction position=GCSC_113:480843..484830 (+ strand)
ATGGCGGGTTCAGACGACCTGATCAACTTCGACGTGATTGAGAGCCAGAAGGAGAACATCCAGTCGCTGCCAGGCGGACG
GTCAGCGAAGAAGTTGGCAGCGTTGTACTCGCCGACAGCAGGGGGTCTGGCGGGGGTGAGCAGCAGCGGCAGTGCGAGCA
GCAGTGGGAGCCGACGGAGCGAGCGGCTGAAGGCACAGCTGACGCCGACGCCAAGTCCGGGGACAACGCGAACGCTGCAC
GAAGCGATCCGGGCCAAGTTTGAGGAGGAGGTAGCGAGCCTTTCGGAGGCGGACGACCCGCTGGATGTGTATGACCGGTA
TGTGCGCTGGACGCTGGAGGCGTATCCAACAGCGCAGGCGACGGCCGAGTCGCAGCTGCATGTGCTGCTAGAGCGAGCGA
CGCGGGCGTTTGTGGGCGCCGCGCAGTATCGCAACGACCCGCGATATCTGCGGCTGTGGCTGCACTACATCCGTCTCTTC
TCGGACGCACCGCGCGAGGCGTTTGTCTATCTGGCCCGCCACGGCATCGGCGAGAATCTCGCGCTGTTCTACGAGGAGTA
TGCCGCCTGGCTCGAGACGGCCGGTCGCTGGATCCAGGCCGACGAGGTCTTGCGGCTGGGTATCGACCGTGCTGCCCGTC
CCGAGGCACGTCTGCTGCGCAAGTACGCCGAGTTCGAGCAGCGACGCACTGCCGCCAACGAGGACGACCCCGACACCCCC
GGCTCGCCCGCCCTGCCGACTGTTCGGCCGGCCCTCGCGGCCAAGGTCGACCCTTTTGCCGCTGCGGCGGCTGCTGCACG
TGACTCTCAGCAAGAGCAGCAGCAGCAACAAGAGCAACAGCAGCAACAGCAACAACAGCAACAACAGCAGAGACAACAGG
CGGCTCGCTCGGCCAAACCAAAAATGGCCATCTTCTCAGACGCAGTCGCAGTTGAACCGCCAAAGGCTTCGGCCATGCCG
GCTCTGGGCGCGGCTGCCGCAACGTCGAAGGGCTGGCAGAGCATCGGATCGCTGGCGGAACGGAAAAAGGAAAACACGGT
GGCGGCCAAGCCGTGGGCCGGCGAGAAGATGAGTGCCGGTGGCAAAAAGGTCACCTCCAAGATGCCCATCTTCAAGGACG
CGGTAAGCTAGATCCTCTCTCTCCCGTTTGGCCCCTCCTGCCAGAAACGATGTTGATTCATATAGGACTAATGTGTGCGC
GTGGGACTCTTGTATTTTCGGTCATTCTGGCGCAATGTATTCTCTAGTCACTAGCAAAATCACACATTACAATCCACCCG
TCACAATACCAGGTTACGGTAAATCCCCAGAGCGGGAAGAAGGAACGCGTCTTTGTCGACCTCCGCGCCGTGTACCCAAC
GCCAGAAGTGCCTGGCTCCGAGCTGAGCTTCGAGGAGATTTGGGCGGCCAATCGCGGCCTGTTGCACCGTCTGTGGGATG
CGCCTCCGGCCGGCCCGTCTGCCGTCGATCTCCTGGCCGACGTCGCGCCCGCAAAGCTCGTCATTCACCGTGATGCAGTA
GTACTCGACGAGAACGGCGCCCCAGTCAAGACTCAGGACCGGGAGAACCGCCCGAGGAAGAAGAAGGCGACGGAGATGAA
CGAGACCCAGATCAGTAAGGCTCCTGTCCAAGCTCTCCGTGTTGTCTGCTTTCTGCTGCGTAGCCTGGATTAACCAATTT
CCTTCCGGTAGTCAAAGCAAAGCTCGACTCGCCGTCGGGTCGCAAGATGAAGAAGCGCGGCTCTATTTCTGAGCCGACCA
TGACGATGCATACCCGGGCGGCCACCGACGACATATACGACATCTTCAACCAGCCTCTCCGACCGGCCATGGGGATCGAG
GAATCCGACACAAATGAAACATCGGACGAGGATTATGAGTCCGATGCTGATTACACGAGCGGTGCCGAAAGCACAGGAAC
GACACGACAAGTTTCGACGAGCGACGCTGGCGACGATGAAGTAGCAGATGAGGTGGACGATGGCGTCGATGGCGTCGAGG
GCGAGAAAGAGGCGGACGATGCAAAGAGCGTCAGCGAGTGGTCTGACTTCACAGCCCGGAAAGACATTCCGGATCTCGAC
GAGGAGGACGATCTGGGCCGAGATCCTGTCGCAGATGAAAACGACGAAAACGACGATGCCGATGAGTCGCTCAGTCCCTT
GCCGGTACGCAGACGGTCACAGACGGCCAGCAGCGGCGATGCACCGTCGATTCCATCGTCACCGCTAATGTCTCCTGTAA
AGGACTCTGGGCCCTCTCCACCCAAGACGCGGACGGTCTTCATCCCCATTCCGCCCGAAGACTATGTTGCACCCACACGG
CCGTATAGGGATCCGGTCGAGGTGGCCAACAACCGTCTGCCCTTTATGACTCCCATCACAGAACGGACGGAATCGTCGCT
GGCGTTTGACTCGGACGACAACAGGCGTGCGCTGCTTACTAAGACGCCGAGCAAGGCGTTTGGCATGGCCACGAGGCTTC
CGAGCACGGACGAAGATGACGAGGACGAGGAAGAAGAGGAAGAAGAGGAGTACCGCGGGGGTAGCAGCGTCGGCATGGCG
TCGGAAGCCATGAGCAGTCCGTTGATCAACGTGACGGACGACGACAACCTCATACAACTGTCGCCAGCGAAACTCCCAGC
ACCACTGTTTCAGCGGCCTGCAGGCCCCAACAAGGGACCCATCATCAAAGACCTGCAGTGCAACCCGATCGACGAGAGCA
TCCGGTCCGAGATCTTGGCCCAGATGCACCCACCTCTCAGCTCCTATGCCGGCTTCTATGACCATAGCGAAGAAAAGTAC
GAAAAGGGTGGCGACATCCGACGTTATGCCAAGGCCGTGAGCAAGTCCAAGGCCGGCAACGGCAGCAGTGGTAGCTCTGA
CCGCACTAGTGGTGCTGGGCTGCCAGTGATGATCATGTTCCCAGACTGCCCGTCGCAATACACATTACGGCGAGAGCTGG
GCGCCGGTGCATTTGCGCCTGTGTATCTGGTGGAAAACATGCATCCGGATGGCGATGAGCAGGCCGGAGCGATATCGCAG
ATGGGACGAGACGTCTTTGGCAACAGCCAGGTACAACGACACAGCCTCGAGGCACTCAAAATGGAGACACCACCAACAGT
GTGGGAGTTCCACATGATGCGGCTGGCACGCACACGACTAGGACCACAGCACCGGGTGACGGCGTCGCTGGCTCCTGGTC
TCGAGTGCCACCTGTACCGCGACGAGACATTTCTGTTCTTGCCGTATTATCCTCACGGCACACTGCTGGACGTGGTGAAC
CTGTTCCGGGCAGAGCCAACCGGGGTGATGGATGAGACGCTGGCCATGTTTTTTGCGATTGAGCTGTTCCGCACGGTGGA
GGGACTGCACAGCCACGGGTTACTGCACGGTGATATCAAGGCCGACAACTGTCTGCTGCGGCTGGACGAGTCTGAGCAGC
ACCAGCACCAGCACGCGTCGCTGTCGGGGCAGTGGCACGCGGACGGTACCGAGGGCTGGGGCTCGCGTGGCGTGACGCTG
ATCGATTTCGGACGGGCCATTGACATGCGGTCATTTGCGGCGGACGTACGCTTTGTGGCAGACTGGAAAACGACAGCACA
AGACTGTGCAGAGATGCGAGAAGGTCGGCCGTGGACGTGGCATATCGACTACCACGGCCTAGCCGGGACGCTGCACACGC
TGCTCTTCGGCAAGTACATGGAGACGGTGCGGTGTGACCAGGGCACGGGGGCGACGGTGAGGCGGTACCGCATCCGTGAG
TCGCTCAAGCGGTACTGGCAGACAGACCTGTGGTCGGAGGCGTTTGACGTGCTGCTGAACCCGGCAGGTCACGTGATGGA
CGAGGAGGGTGCGCGACTGCCGGTGCTGCGGTCGATGCGGGGCGTGCGCGATCGGATGGAGACGTGGCTAGCGGCGAACT
GCGAGCGTGGCGTTGGACTGAAGAGTCTGATGGTGAAGGTGGAGGGATGGGCTCGCGGAAGGAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62