GenePrediction:GLEAN_3719 Details

Name: GLEAN_3719
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:502522..502977 (+ strand)
Length: 456
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:502522..502524 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_113:502582..502699 (+ strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_113:502784..502977 (+ strand)
Length: 194
>GLEAN_3719 class=GenePrediction position=GCSC_113:502522..502977 (+ strand)
ATGGTAAGCTTCGGCTAACCCCCCCCCACACCTTGAAAGATGCTGACAATAACTCCACAGTCTCTGGACACTCAAGCATA
TCTGCTTGCGGCCCTGACCGCATCCGGTGGCGTCGTGGGTTACGCCAAGACCGGCTCCGTCCCGTCTATCGCGGCAGGTC
TTACCGTTGGAGCTCTGTGTACGTGATAGGCCGAATGACCTCTTTTCCATCGTGCCACACTTCTTTCATTCTTGTCAGCT
AATCTGCTTTAATGTACGATAGACGGTCTGGGCGCTTACCGCCTGCAGAAGCGCCAGCCGTACGGCGTCGAATTGGCCCT
CCTCGCTTCCGTCGTGCTGGGCGGCTCCTCCATTCCGCGTGCTATCCGTCTGAAGAAGCCGGTCCCCATCGTTCTCAGCA
TTGTGGCGACATTTGGTCTCTTACAGTTTGGAAACGCTTTTTTGCACAAGCAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62