GenePrediction:GLEAN_371 Details

Name: GLEAN_371
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1352318..1353600 (+ strand)
Length: 1283
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1352318..1352618 (+ strand)
Length: 301
Type: CDS
Source: GLEAN
Position: GCSC_167:1352825..1353600 (+ strand)
Length: 776
>GLEAN_371 class=GenePrediction position=GCSC_167:1352318..1353600 (+ strand)
ATGGCAGAACAGGCTGTGCCCACGGCCATTGCTGCCGAGGACGAGGCTGCTAAGGCGGTCGCGTCTCTCACGATCGGCGG
AGAGAACGTTGAGAAGGATGCTGCTCATCGGTCTCACGATCCCAGCAGCAACCAGAAGCGGACGGACCCGTTCATGTTTG
GCCAGCGGTTCCTCACAGAAGAGGACAACGTGTTTGAGTACAACGCGTGGGACCATGTCGAGACGGACGACGCATTCAAG
GAGTATGCAGAGAAGCAGTACGAGCTGCAGCGGCAGTCACCGGTGTCTGACTTTGACAAGAGTATGTTTACTCCTTTCTT
TTCACCAATGCCTCTCCCGACTTCTATGATGATTTGCACCAATAAGCATAGTTCATCTGATTTCATGATGACAAAACGCA
ACCATCGTCTTTCGCTCCCATCTGATTAGATTGTCACCACTCTTTACATGTTCTCCATTGCCTTTTCTGCTTTGCAATCG
GTCTTGCTGACACATCTACTCCATCAGCTCGTTTCAATGGCGACCCGGCCAAGTGGTGGAATCTTTTCTACAAGAACAAC
ACGGCCAACTTTTTCAAGGACCGCAAGTGGCTGCAGCAAGAGTTCCCCATCCTAGACCGTATGTGTGAGCCGGACGCCGG
CCCGTCCACCATTCTCGAGATCGGTGCGGGTGCGGGCAACACGGCCTTCCCCATCCTGAAGCGTAACCAGAACCCACAGC
TGCGGATCCACGCATGCGACTATTCCAAGACGGCCGTGCAGGTGATGCGCACGCACGAGGCGTACGACACCCGCTTCATG
CAGGCCGACGTGTGGGACGTCACGGGCACGGGCGAGCAGTCGCTGCCGCCCGGCCTCGCGCCAGCGTCGGTCGATGTGGC
CATCATGGTCTTTATCTTCTCGGCGCTGGCGCCGGGGCAGTGGGAGCAGGCTGTGGCCAACGTGGCGCGCGTAGTGAAGC
CGGGCGGTCTCGTGCTCTTCCGCGACTACGGGCGCGGCGATCTGGCCCAGGTTCGCTTCCGCAAGGGCCGGTATCTGGAA
GAGAACTTTTACATTCGTGGCGACGGGACGCGGGTGTACTTTTTTGAGCAGGACGAGCTGGTGAAGATCTGGACAGGAGT
GGGAGGTGCAGAGGATGGGGATGAGTCTGAGTCTGACGTAGGCAAGACGGCCGGTCTGTTTGAGCTCGAGAAAATGGGCG
CAGACCGGCGACTGATTGTCAACCGGGCGATGAAGCTCAAGATGTACCGCTGCTGGCTGCAAGGACGCTTCCGCAGGCTA
TAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62