GenePrediction:GLEAN_3721 Details

Name: GLEAN_3721
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:508418..509618 (+ strand)
Length: 1201
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:508418..508505 (+ strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_113:508837..509085 (+ strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_113:509185..509618 (+ strand)
Length: 434
>GLEAN_3721 class=GenePrediction position=GCSC_113:508418..509618 (+ strand)
ATGAATGATTCTCAAGACCCACAATCGAGCTCACTCGGCTATGAGTTCGAGGTGAAGGAGCAAGACCGCTGGTTGCCCAT
AGCCAATGGTAAGCTCCCCTTCTTATACTACCGATCCCCATTCATCACGATCTGTACGCACCGTGTGCCGTTACTTGGGG
GGCTTCAGGAGAGTGTAGCGCACATGTACGAGCCGTACAGACTGTGATACCTCTCACAGGCGAGCCGGAGGGAAGGGTAG
AGGGACGGTGGCTGTCACCCCCTGGGACTCTGGGAATCTGGCCAATCTATTCCACGACCTTCTCGTCTGGGATAGGCCTT
TCACAGTCAAGCGGTAGCTCGTTGCTTGCGAAAGACCGTCGTCTCATTAGCAGCCAAACCAAGCTGTTGATATTAGCAAA
AGCTACTCGCTGTTTCCAGAGACCCCTCTCTCACCTTATATTCTCATGTCTCGGCATCAGGCCTCGCCCTCCGAGTCCCC
GGATGGAACTGGCGGCTCGTCCATGAGGGCCAGCAGACATGATGTGTACGATGCTAACATTCGAAACTTCGCTCCAGTCG
CTCGAATCATGAAAAACGCACTTCCAGAGAACGCAAAGATAGCGAAAGAGGCCAAGGAATGCATGCAGGAATGCGTCAGC
GAGTTCATCTCTTTCATTACCAGCGAAGGTTTGTCGCTACGCGCCTTTGCCTGTTTTAGTCCCGACTTCATGTGTAGAAG
GGCTGTCTTCGACACTCAAGCTAATGGTGTTTCCCTACTGCCTATAGCTTCTGAGAAGTGCCATCAGGAGAAGCGGAAAA
CTGTCAATGGCGAGGACATTCTCTTTGCCATGACATCTCTGGGATTTGAGAATTATGCCGAAGCCCTAAAGATCTACCTC
TCCAAATATCGCGAAGTATGGTCTATTTTCCCGGTCCACGTTATTGGCGTCCTTTTGTGCTTCTGCACATGCCTTCTGTC
CCCTTTTTCTAATGCGTCGTGGCAGCAGTCTCAATCAAACCGAGGTGATAATCAACAAGGCCACCCAGGCGGCCAAGGCT
ATGGCACCGCGGGGGCCGCTGGTGCTGGTGCCCCTGCGGGCTCCTTTGAGGGGGGGCCTGATCTATCTGGACAGCCAGCC
GAGGGTGGAGCAGATGCCTCTGGCTACATCTACGGGGCCCAGACTGGTCATAACGGGGCTGCCGGTGGCGACGGGTACTA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62