GenePrediction:GLEAN_3722 Details

Name: GLEAN_3722
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:511095..513398 (+ strand)
Length: 2304
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:511095..511719 (+ strand)
Length: 625
Type: CDS
Source: GLEAN
Position: GCSC_113:511793..511836 (+ strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_113:511893..513398 (+ strand)
Length: 1506
>GLEAN_3722 class=GenePrediction position=GCSC_113:511095..513398 (+ strand)
ATGATGGCCGGTCCATCTACACCGACGACGGTCGACCACTCCGGTCTTTTGTCTCCTGTTAGCAGTTCAAGCGTGCCCAT
CAAATCGATATTGCGGATCAACTCAAGTGCGAAAAAAAGCACGACGTTTTCCTCCAACATCGGTAGGAACAAGTTGAAAA
GGAAGCTCAACGACCGGTACGACGGTATAGAAGGCAAAGATGACATATCCGAGACGGAAGAGGACGAGCAGGATGAGCAG
GACGGCAAAACACGAAGCCCCCTAACCAAGAGACAAAAAACCGTTCACTTCGACCTCAGTTTGAACATCACCACCGAAGT
CGGCAAACGCACGCTAGAAGAAGCAAAACGCTCTGCCCGCCATGCTCTCGAAACGCATGCTGCTGGCGACGACCAAGAAT
ATATAGAGCTGCAAGAGGCATTCTCAAACGACAGAGACCAATTTCACAGCCCAGGAGCAGACGAGGAAGAGGACAGTGTG
AGGCCAGAAGAACTGGTCCTCTATGTCGTCGCACTGACGAACTGCACTCCAATGCTAAACAAGTCATGTGCGACATTGGT
CAAACAGATTCTCAGCTGTTCTTGGATTGGACGTGACGACAAGTTCTTTCGCGCATACGTGCAATGTACGTCCTCTCCCT
ATATGTCGCTCATACGGCAAAGCGTCAGATTGGTTCTGACAGCCTTTAGTTCTAGCAGCGTTGGTTAGTGCTCAGGGAGT
CTATTTGCGCCCTGTCCTAGAGGTAAGCGGTTCATAGATGTCGTTGTCAGCCGTATAGTCGCTAACCTATACCGATAGAT
GATTGTCGATTTGTTCATGGAACCCCGCCCATCATCATGGCGCGTCCCTGACTTCCCCACCGTTGACCGCGAGACGGCAC
AGACGAGGCTGCATTTTGGGCTCGAATACATCCTGCAACTATTTCCGGCCGCGCGATCTACAGTCTGTAAAATTGTCTCT
CAAAAGTTCCCGTTCCCGAGCGAGCATAAAAGCGTATACCTATGTTACCTCGACAATCTTCTTCAACTACGCAATTACGC
ACCAAAGCTTGGACCTGAACTGCTTGAGGCAGTAACATCTAACCTGGTCAAGATGGATACCGAGTTCCAGCTGGATCTCA
GCGACATGGACGACGACTTGGTATCCAGAGTGCTCTACCAAGTGACAAGCAAGGATGACGACGATGATGAAAACGATGGC
GATGATGCGGATAGTGAAGGCGACGAGAGTGATCTGCCCGGTTTCGGCGAACCGGACTACGATGAGGAGGCCAGCAAGAT
CGACAAGTCTACAAAGTTGGTACAGAAGCTAGACGCTATCCTCGAGCGGCTCTTCTCCCTCTTTGCTCCCGTGTTCGAGG
ACCCGGACTCCGAGGCTTCTCAGGAGTGTCTCGGAGACATGATGTCTGACTTTGTCAACTTTGTTCTCACTGTACCCAGT
TCCCGTCACACACAATTCCTCGTCTTTCATTTCAGCCAGAGAAGCCTCGCCTTGCAGGACATCTTTACAGGAACATTGCT
GAATCTGGGCTTTGAATCCAACCGGCCAGCAACAGTGCGCCAAGCAGCTGCTTCATATCTGAGCAGCTATGTTGCTCGTG
CGGCGCGAGTTCCACGAGACACGGTACGAAACGTCGTGAGCATCCTCTGTCACCGCATCGACATGTACCGGCGCAGCAAC
AGCGAGGGATGCCGGGGCCCTGACTTGCGGCGGTACCAGGAGCTCTATTCATGGGTGCAGGCTCTACTTTACATCTTCTG
CTTTCGTTGGCGCGACTTGGTAGACTCGCACCCAGACATCGTGGATCCCGACGACCCGGCATCGTTCGTGGGGCACGAGG
TAGAATGGATGCCCGGTTTGAAGCAGGCGCTGACGAACGTCATTTACTCGGTCTTCAATCCGCTGATGGTCTGCTCGCCC
GCAATCGTATCCGAATTCGCAAAGCTGGCGCACTCGATGCGGTTTATGTACATTTTCCCTAGGCTGGAAAGCAACAAGAG
CATCCACCTGTCGCAGTTTGTATCTGGGCACTACGGCAATGGAGATGCGCTGCGGGAAGACGCAGGCTACACGGTCGAAG
ACGAAAAACGGTTGCAGCTGGAGGGCAACTTCCCATTCGACCCATACTTACTACCAGAGAGCAAACGCTGGTTGGAGGGC
GACTATCTCCAGTGGACGCCGATTGCGGGGGTGGGTGGATATGAAGACGGGAGCGACGACGGTAGTGAAGACAGCGACAA
CTTCGGCAGTGCTGATGAAGGCTTTGAGGAAGATACGGCAACTGATCCGGAAGAGGATTTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62