GenePrediction:GLEAN_3724 Details

Name: GLEAN_3724
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:514817..518437 (+ strand)
Length: 3621
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:514817..515844 (+ strand)
Length: 1028
Type: CDS
Source: GLEAN
Position: GCSC_113:515905..516459 (+ strand)
Length: 555
Type: CDS
Source: GLEAN
Position: GCSC_113:516871..517026 (+ strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_113:517171..517232 (+ strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_113:517294..517552 (+ strand)
Length: 259
Type: CDS
Source: GLEAN
Position: GCSC_113:517609..518437 (+ strand)
Length: 829
>GLEAN_3724 class=GenePrediction position=GCSC_113:514817..518437 (+ strand)
ATGGTTCATATCGAGGCTGACGGCAGCCGTACAGAATCTGGCCGCATTAATTACCTGGGCAAGGTCAATACCACTGACCC
GTACCTTTGTGATGACGATAGCAACAGCGACGAGGATGCTGGCGAGCAGAATAAAGATGACAAAGGCGGATCAGTAGCAC
CCGGGGGAACCACCCTGACCAAGGCGCAGGCCCGTCGCGCTCAGGTCCGCCGTGCCCAGGTCCAGCACCGGAAGCGCAAG
GCCGACTATCTGCGCCAGCTCGAGGTTGATGTTTCTACACTTCGTGACCTTGTCAGCGCGACCGAAAAGGAAACCCGCAG
ACTGCGGCACGAGAATGCTAGCATCCGCGTGCGCCTGGGAATCTCTGTTGTTGGTTCTGGCAAAAACAATATCATCGTGC
CCAGCAAAATCGATTCAGTTATTAGCGCAGACACGAGCCAGGTTATGGCCCTAGATGTGCCAGCAGTGGCTGTCTCTTCT
CTAAATGATGTCACCGTTGGTGGGGATATTGGTCAGCTTCTTTCACCGTCAGCGCCGGAAGTATCTCCTGCGACAACACC
ATGGGACGTCAGCACTATAACAACGGGCCCCTCTCCCATGAGCCTGTCGTCATCTGCATCACCGGCTGCTCAGGGAGTCC
TGCCTATCGCTCTCGCAGATACCATAGACGCCAAGGTCGACGCCACCGGCTCCTTGTTTGCCAACATCGACCTCGACGAT
ATTACGGTCGCTCTGGTTATGGACGAATTCGTTGGCACACCAGTTTACCACATTTCCAGCTCGTCCGTCTCGACGTCGTC
TCCACCTTATGACGAAAACTCCGCCGTCCTACAGAGCTTTCCGACAACATCGATTACAACTTCTCCTGCTTACAATTCGA
TGACAACATCGGCCATAATACCTATGGACCCGGCCTTGGTGTCAGATGCATCCTCGCCTGTTAGCCCAGAGCCTGGCCTG
CAGGGATATTCATGGATGCAGGAAATGACCCTGGAACAAGTGCACGTGGCTGTTAACTTCATTCTGGCGTGAGTACCCTG
TCGCTCCTTCCATGCTTTCTTCGTCACAGCTGGTACTAATAATCGCAGGCTCGAATATGTATGCTGGAACCATGTTGGTC
ACCAGTTCTGTCGGCCCAATACTGGGGTGCCGCATGCCGGCCATACTCTTATGGCCTCGAACCTGCTTCTTCAACATGCG
TCTGATAAAGTACACATGGACGTGTATGATTTTAACGACAAATACGAGAGTGAAATCAATGACCAGGCTGGCCATACCCA
CGACACAAGCTTTACCGGAAGCAACGACAATCATGCTGTCGATTTAACGTGGCAGGCTCCCGATGTGACTCTCCAGCAAC
TATATGGACTGGCCACGTCGTTAAATCCGGCATCAGACAAGGAGCTGACTCCAATAGAGGCATGGTTCGAATTGGCCTCG
AACTACCCTCTATCGATACTATTGCGACAGGACGTCATCGATGAGCTCAAGCGTGGCTTTTCCGGCGTTGTCAGGTGTCT
GTATTTTGGTGCTGTCATAGAGCGCCAGGCGTTTGAAAGTGTGGTCGATCGCATTCTAGGTCCGATAATGTCTGGCGAGG
CAGCCATAGCTAGAATACAACCCGCGGAACATGCGATATTGGCGTGAGGGATGCGTCTGATGGCTCGGGCGTTGGCTTTG
TTGGTTTTGAAACAAACGGGACTATATGCTAGGACACACCAGCGGTGGCATATGTTTTCCCTGGGAGAGACCCTGTTAAT
TAAGTTTTACATTAGCAGCGATGGTCAGTGCCACAAGGTGTTACTTGTTTGTGATTTATATATTGTTGTCGACTCATATC
ATTCCTAATACTCCGGGCGACGTTCTGAAGTAAGAAGGAGAGACACGCCTGATTACATGACCCACTTGCGGCCGGTACTT
GTTATCTAAGCCGTTTCCGTCCTGCGCTGAGTCTCTGGAGGGGCTTTCTTAACCCCTCATGAACGATGGTAGATCGCTGC
TTGGCCGCGAAAACGCGCTGGATTGGCCTACCAACGCACTGAACTATCACACAGTCCGCAACATCTCCACGAGCAACATT
CGGCCATCTCCTACGACATCACACATGGCAAGCTTATTTCTTCGGCGTTTTGCTACACAAACCTGGAGAAACCCCGATCC
AATCCGGTTTCAGACGGGTTTCTCCGCTTTTCCTATCATATCGAGTACCGGTAAGCATGTCAGCCTGCGGAGCAAACAGA
TCTCCGTCCAGTAACCACTAAGAATCTATGTATGACAGGGAACTGCCTTCGTCCTATGTCCGCCTGTCGATCGTCGCAGC
AACACACCCGACAAATATCTTTCACAATGCAAAGCCTCGCAAGCAAGCCCAACAACTGGGTCGGCAGTGCCGGCGCCGGT
GGTTTCGATCTCCGGAGTAGGATGTCCCCCTTTTCCTGCTGCCCCCATGTGTATGGGCCTTAATGCCAACTCTATAGGTG
ATACTATGACAACGCCGACGGCGTCTATGCTGGCTGCAATCCACAACACCACTCTCCTAGACGACGTCTTGAAAGAAGAC
CAAACTACCATAGATCTTGAGGCTCACTGCGCCAAGCTGACTGGCAAGGAGGCCGGGCTCCTCGTGCTGTCCGGAACCAT
GGGCAATCAGGTGGCGCTCCGGGCGCTCTTGAAGCAGCCGCCTCACTCGGTGCTATGCGATAGGAGGTCGCACATTTTCA
CATACGAGGCCGGAGGGTGAGTGCTCCATGACGTCTGTTTCTGCAGGAACAATCCTAATATACCGTGACTAGGTTGAGCT
CTCTGTCTGGAGCCATGATAATTCCAGTGCAGGCTAAGAACGGCATCCACCTGACGCTCGAGGAGGTCAAAGAGAATGCG
GTGCTGGGCGACGACATCCACGGCTGCCCAACGCGGGTCATCAGCCTGGAGAACACGCTGAACGGCATGATCATGCCACT
GGACGAGGTGCGGCGCATCTCCGACTGGGCGCGCAGCCAGGGCATCCTCATGCACTGCGATGGTGCACGTCTCTGGGAAG
CTGCCGCCTCGGGCGCGGGCAGCCTGGTTGCTTATTCTGCCTGCTTCGACACCGTCACCATGTGCTTTTCCAAGGGTCTA
GGCGCGCCCATCGGCAGCATTATCGTGGGGCCCAAGGCCGTGATCAAGCATGCCAACTGGATTCGCAAGTCCATAGGTGG
CGGCCTGCGCCAATCCGGCGTCGTCTCTGCCGCAGCGCGCGTGGCCGTCAACGAGACCTTTGGTACCGGCCCCAACGGTG
AGGGCGGCCTGCTGCAGCACAGCCACGGGCTGGCCTTTGAGGTGGCAAAGATGTGGACGGACCGCGGCGGCAAGATGCGC
TATCCGGTGCACACCAATATGGCCTGGCTGGACTTCCCGGCTAGCGGCGTGAATGAGGAGCTCTTCGCCAAGCTAGCCGC
TGCCGAGGGCCTCAAAATGTACTCTGAGCGGATTATTGTGCACTACCAGATCTACCAGAACCGGCAGGAGGTCGTTCCGC
GGCTAGAACGCCTGTTTACGACGGTACTCGACAAGGTCAACAAGGTGCCAGTAGCAGGTGCCGTGTCGTCAGGAAAGTCG
GCATATCCGGTCAGCAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62