GenePrediction:GLEAN_3725 Details

Name: GLEAN_3725
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:519268..521589 (+ strand)
Length: 2322
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:519268..519488 (+ strand)
Length: 221
Type: CDS
Source: GLEAN
Position: GCSC_113:519636..520304 (+ strand)
Length: 669
Type: CDS
Source: GLEAN
Position: GCSC_113:520359..521589 (+ strand)
Length: 1231
>GLEAN_3725 class=GenePrediction position=GCSC_113:519268..521589 (+ strand)
ATGGAAGCCGTTGGTTCGCTTTTTCACAGCCTTGCTGCTGTCGCAAGCGCTTCTGGTACAATTTTTACGATTGCAACTTT
ATTGGTTCAGCCGGCTCTGGGCTTGTTCAACAATGTATCAGTTATCGCCCCCTGTGATTCAGTCCTGTACTGTTATGGGG
ACATTCTTACGCAGATTGAGCTCGCGGCACCCTTTTCGGACTCCAAGACCTTTGTGGATATGTGCGTATCCCCCTCTCGT
GGTCATGTCAAGGCAGACTGGAGGGCTTGAGGCTGTCTTGCCTTTCGTGTCAACAGACACGGATTTTATGTTCCACAAAT
TAAATGGAGGCTTGTTTTGTATTACAACCTCACTGACTTATGACACAGGCCGACCATCCGACCCTTGGACGAAGTTGTAG
CAGCATATGAAAATTTGACCAAGCCGTTGACCAACAATACTGAGCTTATCGACTTCCTCAGCACATACTTTGCTGCGGCT
GGTGGCGAGCTCCAGAGCGTGCCGGGAGACCAACTCACCACCAATGCGACGTTCCTCAAGAAGCTTAACGATACAGTTAT
CCGCGAGTTTGTGGAGAAAGTCATTGACATCTGGCCGGACCTGACACGGCAATACACCGGCGGGGTGGCCGGATCCAACT
GCACTGGCTGCCAGTCCAGCTTCGTGCCCGTCAACCGTACGTTCGTCGTTGCTGGTGGCCGATTCCGTGAGCCTTACTAT
TGGGACTCTTACTGGATCGTCGAGGGCCTGTTGCGCACCGGTGGCTCCTTTGTCGACATTTCGCTCCACACGATTGAGAA
CTTTCTCGATTTTGTGGACAAGTTCGGCTTCGTCCCTAACGGTGCCCGCGTATACTACCTTAACCGTTCACAGCCACCTC
TGCTTTCCCAGATGGTGCGCATATACATTGAGCACACCAATGACACGTCCATCCTAAAGCGAGCTCTGCCACTGTTGATG
AAGGAGCACGACTTCTGGTCTATCAACCGCTCTGTGTCTATCATCGCCCCCGACAACCAGACATATACTCTGAACCGGTA
GGCTTTCCTCTGCAGTTCTGATTTGCCCCTGTTCATTATTGACAAAGTCAGTTACTCTGTCCTGAATAATCAGCCACGGC
CCGAATCGTATCTAGAGGACTACGTCACGGCCAACAATAAATCATACTATTCTGGGTCTGGCTCGGTTTACAACGAGACA
AGGCCACTCAACGGCTCCGAGCGAGCCGCTCTATATTCCCAGCTCGCAAGTGGTGCAGAGTCAGGTTGGGACTATGGTAC
TCGTTGGCTGGCGCGACCTGAAGATGCTGCCAGAGACGACTACTTCCCTCTGCGGTCACTCAACGTCAACAATATAGTAC
CTGTCGACCTCAACTCGATATTGTACTGGAACGAAGTGACAATCGCCAACTTCTTAAACGCCACTGGAAATCATACAGCA
GCTTCTTCGTGGGCCAAGGCTGCTAAGAAGCGCAGTGATGCGATGTATGCCTTGATGTGGAACTCTACTCTCTGGAGCTA
TTTTGACTACAACATCAGCTCTCACGCCCAAAATATCTACGTGCCGGCTGATGGAGACACCACCGCAGCAGATAATTCAA
CAGCACCGAATGGGACCCAGGTGCTTTTTGACGTCGCCCAATTTTATCCATTCTGGACAGGTGCTGCCCCATCACATCTC
AAGGATGACCCGTTGGCTGTGAAGCTGGCATACGCCCGTGTCAGCACCCAGCTAGACACTAAAGCGGGCGGTATTTCAGC
GACAAACCTGGAAACGGGCCAGCAATGGGACCAGCCAAACGTGTGGCCACCGCTGCAATATGTTCTGATGCAAGGCTTGC
TAAATACCCCTGCCAAGTTTGGCACCGACGATTCGGACTACCAGAGCCTCCAGGATCTCGCGCTGCGAATTGGCCAGCGG
TATCTGGACTCGACATTCTGCACCTGGTATGCCACCGGTGGCTCGACATCCCTAACACCACAGCTTCCCGGACTAACGTC
AGCGGACAATGGCACTATATTCGAAAAATACGCTGACAACTCGACCAACGGTGCCGGTGGTGGTGGCGAGTACACTGTGG
TGGAGGGATTTGGCTGGTCAAATGGCGTTATACTTTGGACGACCGACACTTTCGGAAGCAAGCTCATGCGACCCAACTGT
GGTAACATCACGGCAGCCAGTGTCACTCCAGGCAAGCGTAAAAGAAGTGCAGACAGCGGTGGCCCAGCTCATCGTTCCCG
GCCACCCAGCGCGGTTCAGTTAGATGCATTTGACGCCACTTGGACAAAGATGTTCGGCAGGTACGACAGGGATAGAAAGT
AG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62