GenePrediction:GLEAN_3726 Details

Name: GLEAN_3726
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:523144..524579 (+ strand)
Length: 1436
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:523144..523336 (+ strand)
Length: 193
Type: CDS
Source: GLEAN
Position: GCSC_113:523402..524357 (+ strand)
Length: 956
Type: CDS
Source: GLEAN
Position: GCSC_113:524406..524579 (+ strand)
Length: 174
>GLEAN_3726 class=GenePrediction position=GCSC_113:523144..524579 (+ strand)
ATGGCAGCCAAGTCCAGATTCACGAGGCTCGATGCCTTCACCAAGACAGTCGAGGACGCGCGCATCCGCACAACGTCGGG
CGGCGTTGTGACGATTGTGTCGCTGATCGTGGTGCTTTACCTGGCCTGGGGCGAGTGGCTGGACTACCGACGGGTCATCA
TCCGCCCAGAGCTGGTCGTGGACAAGGGCCGAGGTGGGTTTGCTGCTCCAACAGACAATTCGCGACGGTGTGCTGACACA
GGGTGTTTGCTGGTGTAGGCGAGAGAATGGAGATTCACCTGAACATCACGTTTCCGCGGATTCCGTGCGAGCTGCTGACG
CTCGACGTAATGGACGTTTCGGGCGAGCAGCAGCACGGGGTGCAGCACGGAGTGCGCATGGTGCGGCTGGAGCCGCAGAG
CAGGGGCGGGTCCGAGATCGAGGTGAAGACGCTGGATCTGCACGCGGACGCGGCTTCACACCTGGACCCAGAGTACTGCG
GCCCCTGCTACGGTGCGACGCCGCCGCAGCACGCGATCAAGACGGGCTGCTGCAACACGTGTGACGAGGTGCGGGAGGCG
TATGCGTCGTCGTCGTGGGCCTTTGGCAAGGGCGAGAACGTGGAGCAGTGCCAGCGCGAGCACTACGCGGAACGCATCGA
CGAGCAACGCCACGAGGGCTGCCGCATTGAGGGTGGACTGCGCGTCAACAAGGTGGTGGGCAACTTCCACATCGCGCCGG
GCCGCAGCTTCAGCAACGGCAACATGCACGTGCACGACCTCAAGAACTACTGGGACATGCCGACGCCGAACCTGCACTCG
TTCACGCACACGGTACACTCGCTGCGTTTTGGCCCGCAGCTGCCCGAGTCGCTGCAGAAGACGCTCGCTGGCGGCGGCGC
CAAGGGACAGCCGTGGACGAACCACCACATCAACCCGCTCGATGGGGTGATGCAGCAGACGTCCGACCCCAACTTCAACT
ACATGTACTTTATCAAGATCGTGCCGACGTCGTACCTGGCGCTGGGCTGGGAGAAGACGTTCCGCGGCTTCGTCGACGAC
CATGACTCGGCCGACGTCGGCTCCTACGGCCTGCTGGCCGATGGCAGCGTCGAGACGCACCAGTACTCGGTCACGAGCCA
CAAGCGGAGCCTCCAGGGCGGCGACGATGCTGCCGAGGGCCACCAGGAGCGTCTGCACGCGCGCGGCGGCATCCCGGGCG
TCTTCTTTTCTTATGTACGTCCTACGTTCTTGCTTTTTCCTGTGCTTTACTGACCTCTGCAGGACATCTCACCCATGAAG
GTGGTGAACCGCGAAGAGCGGGCCAAGACATTTGCCGGCTTCCTGGCCGGTCTGTGTGCTATCATTGGCGGCACGCTGAC
CGTGGCTGCAGCCGTTGACCGGACCGTGTTTGAAGGCACGATCCGACTGAAGAAGATGCGGTCAAAGGACCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62