GenePrediction:GLEAN_3727 Details

Name: GLEAN_3727
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:527576..530185 (+ strand)
Length: 2610
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:527576..529808 (+ strand)
Length: 2233
Type: CDS
Source: GLEAN
Position: GCSC_113:529868..530006 (+ strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_113:530071..530185 (+ strand)
Length: 115
>GLEAN_3727 class=GenePrediction position=GCSC_113:527576..530185 (+ strand)
ATGTCTTCACAACACCGCCCAGATTTTATCGACGTTCGCGCCCAGGCGAATGACAACAGCAGCACGCAGCCCCTCAAGTC
TCCCCTTAGGTCCCCCCCCCTCAGGTCACCTCGTCTGCCTGTTGCCGGCGATGTTCCGCCAGAGCTATCACCGCTAGATG
CCTTTGCTTTGCAGAGTCGCCTGCTGGCGAAGCAGCTCGAGGACAGCGCCAAAGCTGGTCACAGAATGAGTCGGCTTCCT
CCCTTGACGACGTCGAGTCCTCTTGTTATGCAGGGCCGCTCGGATTTCTACCGCTCAATGTCCTACGACAACAGCTTGGA
TGGCGACCGTGAATCTTCCGACCGCCAGGACAAACCGAAGTCAGCTGTATCACAACCAGTGACACCGGCAGGCTTGGGTG
CTAAGACCCCCGAAGTCGAGCAGCCCATGGTGCGACCCCAGTCCATGCATCCACGAATGAGTCGTGTTCCGCCGACTCCT
GATGACAGCGTACCGCCACCGGTGCCAGAGTATGCCCGCGAACGCCAGGCAATGTTATTGCGAAACAACGCGAAGCCGGC
ACCCGTGGCTGAAAACGAAGAGACGAGCTACTTTGGCGCACGGAGGGAGCGTTCGCCATCTCCGCTTGCCGAAGAGCTTT
TCAACTCGCAGCCGCCTCGTGTGAAAAGGCCGTACAGCTTTGAAATCAACAATGCGGCCAATAATGTCCAAGGGGATGCG
GACCCGATATCACCGCTGGCACAGCCAACACAGCCGGAACAACCAGAGCAGCCGGAAAAGCCAGAGCAGCCAGCACCGCA
AACACAGGCACAGGCCGATGCAATTTCTCCAAACGACGCGAGCCAGCCGAACACAGGAACACCGCAGTTCTCAAACGCTT
ACTCGACGTTTGCCCCGTTCACGCAGTCCCCGGAGAGACCACTGCACAGCAAGAGCTCGTTCGATTCAAACAGCGGTGGT
CTTGCGCCACCCCGAACCCTGTTTCCAAAACGCTCGTCGAGCATCATGTCGGCACCGGTCGAGATGGCCGACGAAGATGG
CCGTAGCACTATGGCCTCGTCATTTTGTTCAATAAACGCTCCGAGAAAGCTGTCAGCTAGCAGCGTGGCATCGCCCGGGT
ACGGTTCTTTCCATCGGTCGCCGTCTATTTCTTCCGACATGTCTGTGCCTCTTCCCCGGCCTTCTTTCAACTTTTCTCGG
CCAATGAGCCGTGTTGGTACTCCTAGCCTCGAAACCCCAGCTCGACAGGCTTCATCCGACAGCCAGACGTCGTATAGCCA
GTCATCTTTTGTTCTGGCCGACGACACGGCAAACACTCCTGTCAGTATGAACAGCGAGGGATTTCCAGACTCGCTTATGC
TATCCGATGACAACCGAATTGTCCCCCCGTCGTATGTTTACTCAAAATACAACCTGCCGCGTGGCAAAATGCTTGAGAGG
TCGAATGCTCGGGATGCAGACAACCAGCCTCAAACTTCCGATCAGTTGGAACAACATATGGTCCCGCTGAGCAACATGCA
AACATTCCCTCACGGTGGCCAGGCACCGCCGTCCCCACCGTCCCGTCCTTCGAGCGCCGGAAACCTTGTGCCGCGGCCGT
CCGTGGAGCGGAGTAAGCTCAGCACAGAGATGGTAGTTCAAGTCCATGAATTATCGCCGAATCCGAGTCAGACGTCGACT
GACTGTAACCGATCACTTGAGGACGACTCTCGTGGCCGTAAGCTGGGGCCCTCTCACGATTCTCACGACCGTGGTAGGAC
GCCGGCGTCGGTAACTGGGACAAGTGACTCGGCAAGCACCATAAAGGCACACCCGACACATGTACTAGCTACAGCGACGG
AAATCTCGGCCGAAGAACACGTTGACAAGGCCATTGCTCTTCACGAAAAGGGCATGCTGAACGAGTCGACATACCATTTG
CGGCACGCTGCTCGGCAAGGCAACCCAACAGGCATGCTGCTGTATGCCCTTGCCTGTCGACACGGTTGGGGTATGCGCGC
CAATCCGAGAGAAGGCGCCGACTGGCTACGCAAGGCTGCCGATTGCGCCAGCAGTGAGATTGCGGGTGACGAAGCAATGA
TCAAAGAAGGCAAGGTGGTTGATTCAGTGGATCGCAAAACGCGTAAGGCGCAGTTCGCACTGAGCATCTACGAGCTGGGC
GTGAGCTACTTGAATGGCTGGGGTATCGACCAAGACAAGAAGTTAGCTCTGCATTGTTTCGAAGTCGCTGGATGTGAGTA
AACTCGGACGGAGTATGTCTGACGTGTAGCTTTCGTTGCTGACCGTTTCTAGCATGGGGCGATGTGGATGCGCTTGCCGA
GGCTGGCTTCTGCTATGCTCAGGGCGTTGGCTGCAAGAAAAACTTGAAGCAGAGCGCTCACTACTACCGCCAGGCCGAAG
CAAAGGGGATGAGCATGGTGGGCAACAGTTGGTACGTGTTGCAAGCTATATATCCGAAGGAAACTGCTGTTTGCCTAACG
TTTAATCATCTGCAGGATCCACAAGGCCAAGTATAACGATGACAACGAGTCTTTAAAGTCCGAGAAGGAGAAGAAAGCGC
GATCTAAATCACGGAATAGGACCATGTTTGGCCACAAACATAACCAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62