GenePrediction:GLEAN_3728 Details

Name: GLEAN_3728
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:532356..537179 (+ strand)
Length: 4824
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:532356..532469 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_113:532551..533232 (+ strand)
Length: 682
Type: CDS
Source: GLEAN
Position: GCSC_113:533284..537179 (+ strand)
Length: 3896
>GLEAN_3728 class=GenePrediction position=GCSC_113:532356..537179 (+ strand)
ATGGCCTTCAGCTTTGGTAGCCTCGGAGGAGCTGCCGGTGCAGGGGCGTCTGCAGCCGGCGGGAGTGGCGTCCAAATGAG
CCAGGGGTCTGATCTTGAGCTGATCCAGACGGAGGTATGTGAACACGCGATGCTACCACGAGTGCAGATAGCTTTCCCGA
CTTGTAGCGATGGCGACTAATGTGAGGGCCTTCAGGGCGTTGGATTTCTCAGCGTTGCCGGCGACACAAAGCTGCAGCTG
GTCTCGAAATGGAGCGAGCCGCCTCTCCCGACCGCCTCCCTCATCAGCGTGGCCTCGCACAAGGGCCTCGTTGCAGCAGC
CGGTCCCGATGCCGTCCGTATTGCCACGACCGACTCGGTACGGAAAGCGCTCTCGGCCGAGGGCAGCGGTGACAGCGACG
GCGATATCCGGCCGTTCACGCCGCAGGTGACGATCCCGATGCAGCTGCGCGTCTCGCAGCTGGCCTTCACCGCCGACGAG
TCCTTTCTGGTCCTCTCGGCCGAGACAGGCGGTGGTCTGGCCGTCTACGACGTGCAGGCGCTGGCCCAGGGCAGCACAAC
ACAGTCGGCCTTTGAGCTGTCCACCAGCGGCGAGACGGTGCGGTCGCTGGTGCCCAACCCCATGGCCGACAGGGCCGAGC
TGTGCGCGCTCGTCACGGTCAAGGGCAACCTGCTCATGGCCGACCTGAAGCAGCGCTCGCTTCGCAGCGGCCTTGCCGGC
CAGCCCGTCCTGCGCTCGCAGGTGAGCTGTGTGGCCTGGAGCAGCAAGGGCAAGCAGCTCGTCGCCGGCTGTGCCGACGG
CTCCGTCTACCAGATGACGCCCGACGGGCAGGAGAAGGCACACATCCCCAAGCCGCCCAAGCTTGGCGACTACTACGGTG
AGGACGTTCTCTCTGTCTTTCTCCAAGGATCACACTGACCGGCAGCAGCTGCCTCGATTTCCTGGCTGGAGAACGACGTC
TTTCTCGTCATCCACAACCCGACGGCAGGGGGACAGCCGTCGGAATACCACATCATCACGCGGAACACCAAGGCGGGAGC
CGGTCACGAGCTCGTGTACCAGAAGCTCAACGATCCGGTGGAGCCGTTTGGCGACAAAGCACCGCACCATTCTATACTTC
GACTGCGCGACTTCCCTCCTAACCTGCAGGACTTATTGTTGGTGGCATCAACGGCAGTGGAAAACATTGGGCTTCTGACG
CGGTCCAAGGCTCCCCTGGCCAGTAATGTGGCCGCAGACAAGATCACCAACGTCTTTACGACGACAGAGCTGGCCGACGA
CTCGCGGCGTGCCCAGCTGCCAATGTCAGCAGACTACAACGACACATTTCCAGTGGGTGTGGCCCTGGACCTGTCCAGCA
AAGATAAAGTCCACAAGCCGATTCCGACGGACGAGATTGAGGAGTCCCCTGGACCGCTTCCGAGCCTTTGGGTCTTGAAC
AACGAAGGCGTCCTGGTGACATGGTGGGTTGTGTACAACGACTCTATCCGGCAGGGCACAACGTTCCCTGGATTGGTAGC
TGTTGAAGACGGTGCAGCCGCCGCACCAGCATCTGCGTTCTCAGCCCCGAAGCCAGCAACGCCCTTTGGCAGCGCTGCCC
TCACACAGACTACCACTCCGGCTCCGGCGCCTGCTTTTGGTACCAGCGTCGGCCTCGGGGCCAGCTCTTCGCCATGGGGT
CAGGCCAAGGCCGCGTCTGCCTCCACCAGCTCGCCAGCTCGAGCCCCGGCGTTTGGGGCGCCGTCAACCATTGGCAGCGG
AACGGCCTTTGGTGCGTCCGGTGGTCTGGGAACCAAAGCGTCAGTCTGGGGGTCTAGCGCAAAGACACCGGCGTCGCCCG
CCTTTGGGCAGTCCGCCTTTGGGTCCAGCTCAGCCACGCCTACTGCGCCTTCCGGCGGAGGCTTTTCGGCCTTCGCCAAC
AAGACGGCATCGCCTTTCACAAGCATTGCTGCCTCTAGCGGAGGGGCCGCGAACAGCAGTCCGTTCTCGTCTTTTAAGAG
CACGGGACAGAGCGGCTTCGCGTCTCTGGCATCAGGCACCTCGGGCGGCGGCAGCGTCTTTGGGTCTCGGTCCGAGACGA
AGCCGTTCGGGTCTACGACATCATTTGGGGCGCCTGCTGGCGCAAGCAGCACCACTGCTTTCCCCCCACCAGCAACCAAG
GCCACCGGGTCGTCTGTGTTCGGCTCGTCACCGTTCGTCTTGGGAACGACCTTCAAAGCGGATCCCGTAACGGCGAATGC
AAACGAGACCACACCGGCCAAGGCAGGAAGCCTGTTTGGTAGCGGTTTCGGATTGTCGTTGACACAGGCAAGCAGCACAC
CTGTGACAGCAGAGAACACTAAAGATGAAGACATGGACGTAGCAGCGCCACCGGCAGCTGCCGAGGCTTCATCGCCTGCA
AAACCGGCGCCCAGCTACTTTGAGTCAACAACACCGACAACAACACCGGCCCCGAATCGGTTCTTCAGTCCACCGGCAAG
CACAAGCACGCCGTCAACGACGCTTTTCGGCAATGCTGCCGGCACCACACCAAAGGCAGGGTTGTTCTCCCGACCGGGTG
GGCTTTTTGGAACGCCGGGCGGTGCAAAAGCGGACGATAGCACGGCGGCCGATGCGGCGGATAACGAGGCAACACCCAAA
GCAAAGCAGCCGCAGGAGCAGAGCCTCCCCCTACCACCGGATGGCACCAGTAAGGCCGCATTCACCGTTGGCGACACCTC
GTCCTCCTCCGACACGTCTAACAAAGCTGCAGAAGACGACGCCCCGTTGCCGCCGGACCCCTTTTCCAAGCCAAAGAAGG
CAGCGGCAGAAGCCCGACAGGCCCCTGGTTTGTTTGGCAAGCCAGGGGCAGAGCCACCTCTACCACCTGACCCGTTTGCA
AAGCCGAAAAAGTCGGATTCGGAGGCAGCGGCCGAGGCGACCAGCTTGCCCGAGGAGGCACCATTGCCGCCGGACTCTTT
GTTTCGGACATCCAAGAGCAGTGGCGCTGCCAAGGCAGACGCAGTGCCAGCAACACCGTTAGCGAACCCGTTCAGCTCGA
TGAAAGCACCGGTGAAGTCGTCTGGGTCATCGATCTTTTCATCCAACCCCCCTCCTAGCAACGACTCCAGCCTCCGGAAT
CCGTTTGCGAACTTGCCGAAGCCACCGCTATCGCCGACGACGGACGGGTCGGAAGAGGAGGAGCAGTCGGAAGAAGGGGA
GGCCGAGGAGCAAAGTGCAGCTGGCGAGGAGGAAAAGGTAGAAGACGATGACGAAGTAGAGGATGACGAAGGAAGCGGGA
CGGACATTGGGAAAGACGTGAGCCCGAGGATGAACGAGCTGGTCAAGACGCCGAGCCAAGCGACCCACGGGTCCTTTACA
TCGACGGGCCGAGACACCAGCGCGAACTCGACGTTTTCGCACATCGACATGCCACGGTCACAGATCTTTGGCGACCGGGA
GGCGCCGGCACTGCGGCCACCACGAGCACAGGAGGTCAGCCCACGATCTCCCAGCCCACAGCGGCCAACGGCCAAGCCGC
AGAGCGGGCTACCGACCGGGCGGCTGTTCCGCGACGACCCGCAGCGGTCATTCAGTGCACCAGGGACAGCGTCGCAGTTA
CTGCGGGACACGTCGCGACAGACAGGCGGAGGACAGGCAAGTCAGGGATTTGCTGGCAGCGGGATGTTTGGCAGCCGACG
GGTGGCACGAGATCCGAACCTCGAGGAGCAGCGGAAAGCAGACGCACACCGGGCAGCAGAATCGGCCAAGGCGCTCACGC
CGGAAGACAGCTACGAGGCGATGGACCGAGAGCTGGAGCAGGCATTGGAGCCGACGTTGCAGCTGGCGGAATGCGTGTAC
ATTCTGGACTCTGACATTGGCGGAGGCGACTCTGTGGCAGCACAGACGGAGGCGGTGTACCGGGATATCAACCGGATGGT
GCTCGTGCTCCGGGTCAACAGCCGCAACATTGACGCGTTCCTGCGCGGCAACTCGATCGGGGGCCACAAGACAGAAGAGG
ACCTGGACGAGCCGGAAGGCTGGGTGCTGTGCGATGTGGACGATCTGGGAACGATTGTGAGCCGGGAACTGCCGACGAAG
CTGCGACAGTCACGGGTAAAGGGCGAGGAGGCGCTGCAGGCGGCAGCAGAGGCGCTGCTGAAGGAGGCCGGACAGCTGCG
AGTGATGCACGAGGATCTGGCGCGGGTGGTGCAGCTGCAGGTCAGCCAAGACCAGGCGGCAGCAGCAAGAACACTGCCGC
TGACAGCAGAGCAAGACGTGCAGCAGAACGAGCTGCGACGGGCATTTACGAAGCTGATGGGACAGCTGGTGGAGGCCGAG
CAGCAGTTGGTGATGCTGCGGACGCGAATGAGCTCGCTGGCAGCCAACGGAGGAGGAGTGGGAGAGGGAGGAGGTGGCGT
GGTACCGGCACTGCCGACAGTTGATGCGGTGATGCGAACGATTGCCAAGATGACGGCGATGGCAGAGAAACGCAGCGGCG
ACATTGACGTGTTGGAAGCACAAATGCGCAAGCTGGGGCTGAACGGACGCAACGGACGGACCAACGGGCAGTCGAATTCA
CATGTGCATGCGCATTCGCCCTTTTCGACGCCACAGAAACAGTCGAAACGCGGCTCGGGCATCTTCTCGACGCCCGGCAG
TACGCAACGGGCGCTGTTCGCATCGCCGGGAGCTGGAGGCACGCCGACGCGACGGAAGCTGAGCGGCTACACGGACAAGG
AGAAGGAGGCGCTGCGACAGACACGGGCCAGCCGACAACGCACGCTCGAACGGCTGCAGCGGATCCACGAGGCAGAAGGC
CCTCGACACATTGGGATCGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62