GenePrediction:GLEAN_3729 Details

Name: GLEAN_3729
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:544924..546357 (+ strand)
Length: 1434
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:544924..545251 (+ strand)
Length: 328
Type: CDS
Source: GLEAN
Position: GCSC_113:545306..546357 (+ strand)
Length: 1052
>GLEAN_3729 class=GenePrediction position=GCSC_113:544924..546357 (+ strand)
ATGATCGAGAAAACCCGCTTCTGGCACATCGCCCGGTACGCCGTGCCGGCCGTGGTCATCTTCTGGATCCTCATCCGGGT
CGCCTTTCACGAGAAATCCCGCTTCGCAGAGCTCTTCGGTCAGCACCGCAACGAGAAGACCATCTTTGTCGACGACTTTT
TGCTGCTCGAGGTCGATGGCGAGTTCGACGGCTCCGCCATCGAGACGCTCTGCAACAACAAAACTTGGACGCCGGGCATC
GTCCTGACTTGCGAGGCCGTGCCCGGCGGTCTTGCCGATGTCAAGAACGGCATCCTCAGCTGCATCCGGACGGCCATCGA
GATGGGCTGTAAGTGACCGAGATCCGCTGCCGACACCAGATAGACGATGATGTGTTGACCAGCTTCAGCGGGCGTGGTGC
TTCCCGGGATTGTGCGCCGGTCGCACGTCGACATGTCCGTCATCGTGCCGGGCGATGTTGGTCCGCGACGGGGCGTTTCT
CTCGGACACTTCTTCGACCTCGGCCACCTCAACAGCTCGCTCGCGACGTACTGCCCACAAATGGCCGTGTATGAGTCGAT
GAACAGCTTCTTCGACAAGCCCTCGATGCTGGAGGCCACCAAGCTTAACATCTACAAGCTGCCCGGCGTCGAGACGCTCA
AGACGCTGCACGACCGGAACACGCGCGTCTTGGCCCATCCCGAGCTGCTCGGTCAGCAGATCCGCACTTTTCTCAACCGG
AAGAGCCCGCCGGGTGAGCGTCGCTACCCTTATCATGTGCACCTCGTGCCCACGCCGCAGAACGCCTTCCCGGCCGCCAC
CACCGAGTCGGCTGCGCTGTATGCCAACTTTGGCCGGCTGCTGCGCGTGCGAAACGATCTGCGCCGTCTGGCCGCCGCCG
CCCTGTTCAACCTGCACACAGCCTTTGCGCTGCGCCTCGACCTGCACTCGGGCATCCGCGCCGACGCCTTTGCCGCCGTC
GAGCTGCGCACCGAAAAGGACGCCACCAAGGCCGCCTTTCCCTCGTACACCGTCCAGGCGTCCGATGCGCTCAGTTACCT
AACCAACAACAACATGTCTGTTGCCTTTCTAGGCACCGGCGCCACCGTCGCCAACACAACCGCCTTTGTCAAGCGCGCCG
CCGAGTTCGACATCAACGTCGTCACCAAGGAAGACCTCGTCGAGGGCATGGACGCCTCGCTGCTGGGCAGCCTCAGCTGG
GACCAGCTTGGGCTTGTCGATTACGAGCTCATGATGCACGCCGGCCTCTTCACCGGCACCGCCCGCTCGAGCTTTGCCTG
GAATCTCGCCCTGCGTCGCCAGCACGCCTTTGGCACCCCTGGTCCAGCCAACAGCTCTCATCTGGATGGCCACATCCGCT
GGCACGACCGTTTCTCGACCCTCTACGGGAACGGTGGCATCGGTGACGCTTTTGAGCAGACCATCTGGCCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62