GenePrediction:GLEAN_372 Details

Name: GLEAN_372
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1354280..1357371 (+ strand)
Length: 3092
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1354280..1354316 (+ strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_167:1354418..1354854 (+ strand)
Length: 437
Type: CDS
Source: GLEAN
Position: GCSC_167:1354984..1357371 (+ strand)
Length: 2388
>GLEAN_372 class=GenePrediction position=GCSC_167:1354280..1357371 (+ strand)
ATGCAGAACCAGCAGCAGAGCCACCGTCGTCAGCCAGGTAGGTCAAGGCTTTTTCTTTTCAGATCCTGCTGCACGACTAC
TTGAACTGCAAAGATCCTCTTGGAACACAAGACTGACCACTTTTTTACGCCTGTATAGAACTTTCTGGCCGGCTTGTTTA
TGCTGATGCGCGCAGCCTGCCGTCATATCCGTCTGCAGGCCTGAAAGACGACAGCACAGCTGCCAGCATCGCGGCCGCCA
TCGGCTGGAAGAGCCAGCTGCAGTCGCCCAGCGACGGTACGGCCTCGCCGCCGCCGAGCCGTCCATCGAGCACGCCGGCG
AACGCAGACTCGCTCAAGGCAGCCACCACAGCAGCCTCAGCAGCCGCAGCTGCTCTGTACCAGCGGCCGCCGTCAGCCAG
CCCGGACCCACCACCAGTGCCGGTGCCCGTGATTGTAGAGCTGCCGGGATCGTCAGACGTCGGCAGCACGGCCGGATCAT
CGATGGCTGCAGCCACGGCAGCCATTGGGTCTGCCACCAGTCGCCACCGGCGCACGGCCAGCGGCGACTCGGCCATCTCG
CCATCGAGCAGCGCCGTTTCGGCCAAGCGGACTGCCTGGGGCAATTCGGCAGCCAATCACGCGTTCAAGAACAACAACGG
CAACAACGGCAGTAACAGCAACGACAACGGTGTGTCTCCGGCACGGCCAGTCACCGGCAAAGAGCCGTCGTTGCACGCGG
CCAAAGGAGCGATGAAAGCGGCACCACAGCAGCAGCCGCAGCAGCGGGCGCGACACCGCAAGAGCTACTCGTCGCACTAT
CCGGACGGCACAACCACGATGACGCCGGAAGCGGCCAACGCGCTCTCGGCTGCCACGGCTGCGAGTGACCGATTCAGCTT
CGTGGGTGAGGCCGGAGCTGTGCCGTACACCAAGATGGACAGGCAGATGTTCACAGCGACACCGCCGGTGGCGCTGGAAA
CCGAGGACAAGAAGCACAACGACATGCTGCAGGCGTCGGCGGTGGAGATGGCCCGACGCATGTACAACCCGACGGCCGAG
AAGGGCGACAAGGGCACGACAGCGGCAGCGGCACCGTTCACGTCGAGGCTGCAGGAAGAGGCGTACAGGCTGGCGCAGGT
GCGATTGGAGAAGCTCAATCAAGAGCACCAGAAGAACCGGGACTACCGGGACCACTACGTGGACCCGAAGCCAACGTCGT
CAGCCGACGGGGCTGACTCGGACGGGCGATCGTCAACGACGATGTCGAGCCGATTTGCGGTGCGCAGCCGCCTGCAACGA
CGGCGTCGGGCGTCGAGTGACAGCGAGGTGGTGCCGGAGCAAGTGTCAGAGCGAGTGTCGGAGCAGCGGCAGCCATCAAC
GGACCTACGCGGCGCGGCCGAGGTGGACTATGACAAGCGGCGACGGGACCGGCAGTCGGTAATGGCAGCAGCCCAGCGCA
ACGTGCGAGCACAGCTGCACGATATTGACGAGCAGGTGTACGCGAACACGGGCAGAGTGCGGCCGTCGTTGCGGACGACG
TGGGAGCACAAGGCGGCCAGGACGGCACAGGCGCGCAGCGATGCTCGACTGGACGCACAACCGCTGGCCAGCGAGGTCGA
TTTGGGCGGTGGGCGGTTCATGGCGCGCTCCGAGGTCGAGCGGATCGCGGCCGCGCGCGTGCAGCCGCTGCTGGATGAGA
TCAACGACAAGGCCGAGCAGGAGCGCGAGCGCCAGGCCGTGCTGAAGCAGGACGAGCAGGACCGCAAGGACGAGGCCCAA
GAACTCAAGGCACGCGACAAGGAGATGAAGGGAATGTACGTGCGGCTGAAGCGGGAGGACAAGGCGGCAAAGAGGGACAA
AGGCAGTGAGCGAGCACGGGACGGCAGTGGTATCGATGATGACGATGACGACAACATCAACAACGACGACAACGAGGCCG
AGCTCATGACGGCTGCCGCGAGCGATGGCGGGCACTTGTCGCCGTCCGTGTCGTCACAGGTATCGCCGACGTCACCGACG
TCGCCCACATCGCCAGGACGGCTGTCGAAGCTGTTTGCGCGAACATCGAGACTGCAGAGCCGCAAGGCTGTGGCGGCCGA
GGAAGTCCCAGTTACGACGTCTACAACGTCAGCTGCTGTGGTCCCGGCGGCTTCTGTGGTCCCAACTACCCCGACAGCTC
CGGCAGCCCTGGTTGAGTCTGCAGACCTGAGCCCGGCAGCGGTTCCTCGCCTCGAGACAGAAGTCCCAGACGAGACCGGA
GAAGGCCAGGCCCCGGAAGAGGTGTCGCCGCAATCGCCACAGTCGCCGCAGTCGGATGCATCGTCGTCGGGCAATCCCAA
GGCGCGCGTCAAGAACTGGATCAAGACACGCTTCGCACGGCCGCGAGCCAAGTCGACCGTTTCGGCCACCTCAGCCACCG
AAGGCTCTCCCTCCACCGAGCGTGCCTTCATCGGTGGCCACACCCTGACCCAATCCGGGGCAGCATCCACGACCGCAGTC
CATCCTACTGGCTCTCCCGTCACGCCTGCTGTCGCTGCTGCCCCGGTGCATACGCCTCCGTTGCAGGCTACCATCCTGCC
GGCCATTCCGGTAGATGGCAGCAGCCTGGCGACTGGTTTTGGGGTCGGGACCGTCGAAGCCATCGGAGCCGTCGGGACCG
TCGGGACTGCTGCAGCAGTCGGTCTGCCGAGACAGGTCGAGAATGGCGAGAATGAAGCAGACGTGTCCGAAATGTCCCCA
CACGAGAGGCAGCAGACCAGCGACGGGACCGAGAAGACGACAGTTGGCCAGAACACCCTGGCTGCCGAGACGCAACCGGC
TGGTGGCAATAGGTCCAGCTGGGACAGTCACGGAGGCTCCAGCAGCATCTACAGCGCTGCTGCTGCTGCTACTGCTGCTA
CTGCCGCGACAGACAAGACGGACGGCGGCGAGCCACTGCATCCGCCCGTGCTGACAGCCGAGCAGGGCGAAGACAATGGC
GCCGTGGAGAGCGTGGAGCGCAGTGTGTCGCCCCTGTCGGTGCCTCGAAGCATCCGAAATTTGGCGGCAAACAAGAGCGT
CAGTCCGGTGCGCGACTCGCGCTTCTTGGAGGACTTGCACGAAACTGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62