GenePrediction:GLEAN_3730 Details

Name: GLEAN_3730
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:546857..549747 (+ strand)
Length: 2891
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:546857..546963 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_113:547023..548591 (+ strand)
Length: 1569
Type: CDS
Source: GLEAN
Position: GCSC_113:548658..548826 (+ strand)
Length: 169
Type: CDS
Source: GLEAN
Position: GCSC_113:549433..549495 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_113:549571..549747 (+ strand)
Length: 177
>GLEAN_3730 class=GenePrediction position=GCSC_113:546857..549747 (+ strand)
ATGCCTACCGCCGTCGATATCGTCACGCTCGATAATTTCGAGGACAAGCTCCCAAAGTGGAGTCCCGACGACATCAGCTA
TCTGCACGCACTTGTCGATATGGGCAGGTAAGCAGCAGTGCCCCTTCTCGCCCTCCCGTTTGTGTCTTGGCTGACCAGTC
TGGCAGCAATGGGATTCGGTTCACGATCTCTGACCTGGCGCCGCCTTATACGCGCCTGCTGCGCTGCGTATATCGCGAGC
GCGCAGGCATCTCGCTCTTCGATGCGCTGACCGCCAAGGGAGAGCAGCCCTCTAGCAGTGATGGCAGTCCACAGCAGCCA
GCACTCAGTCTCCCCAAAGATACCATTCGGGACGTTGCCAACACGCTTGCCCGCTTCCAGCGCATAGCCCTCGACTTCGG
TGTCCGCCCAGACCACATGGCTGTATTTGCGACCGAAGCCATGCGCCGAGCCAGCAACGCCGCCGAACTACTGGACTCCA
TCGGCGACAAAGCCCCCGGCCTGACCGTCCACGTGTTGGCGCCCGAGGTCGAGACGCTGTTTGGCTCCGCGGGTGCGCGT
GCCGGGTTTGCGTCCGTCGAAGGCGGCCTCATGTTGGATCTGGGCGGCGGCAGCGTGCAGATATCGTATGTGGACTCGCG
GCTGGGCGCTGGCTACGAGACTATGGCAGCACGTACTGGCCAGAGCATGCCCTACGGGGCTGCACGACTGACGCGGCTGG
TAGTTGAGAGCCTGCCGACGGAGACGACGACGACAGCGACTTTGATGATGACGCCAGAGGCCAAGGCAAAGGCCGAGTCC
GAGGCCACCGCTGCTGTGGCCCCTGCCTTGGCTGATGATTTGACGGCCGCATTGGCCCGTCTGCAGGAGCAGTTTTCCGA
TCGAGCAGCAGCTGCCTCTGCCAAGGGCTCGAGCAGCATTGATGTCTACCTCTGCGGCGGCGGCTTTCGTGGCTATGGCA
GCATGTTGATGCACAACGATCCTGTGCAGCCGTACCCGATTCCGATCATGGCCGGCTACACGGTGTCGGGCGCTCTCTTC
GGCGAGACACAACGCATGCGCCACATCAATCACGCCGAGGAGGGCAAAATCTTCGGCTTGTCCAAGCGGCGCCGCCAGCA
GTTTGGCGCCATCGCCACTGTCGTGGACGCGCTCATCACCGCTCTTGCGCGCTCTCACCTGAACATCCGCACTGTCACAT
TCTGTGCCGGTGGCAACCGTGAAGGCGCCTTGATGCTGCGGCTCCCGCCGTCTATTCGCGAGACCGATCCGCTGGTCCTG
TTGGCAGGCCCATCCGCCGCCACTACCGCCATTGCCGATAAACTACGATCTGCCCTCCCTGCAGCAGCATCCAGCGAACT
GCTGTTGTCGCTTCTACCAATCATAGCATCCCGCATCTGGGAGCGCGGCGGTATAGACGCCGCCTCGAACGCCGCCGCCT
CGCTTCACGACGCTGTACACCGCGATCCAGCCACACCTGGACTTCCACACCATGCACGCGCCGTGTTGGCCATTAGCCTG
TGGGCGCGATGGGGCGGCAGCGTGGCGCCAACAGACACCAAGCTCCTAGACGGACTACGACATTTGTTGGGCGACGGCAG
AGGCAGCAAGAGTCACGATGCTGCCGGCCTTGCAGACGACGCATTCTGGGCAGAGTATGTGGGTGGCGTTGCGGCAGTGC
TGGCGCTCCTTTTCCCGGCAGGACCACCAAGTGCAGACGCCCTGAGTTCCGCTTTGTAAGATCAGACCAACAAGCGAATG
CAAGCACTGGAAACCTAGTGCTGACTGCTAACCCTTTACAGATTGAGCGTATCCGTGGGCAAGACGCCCTCGGGCAAGAA
AAACGCCATTGCTCTTCATGTTGCCGTGTCAAGCAGTCGGTCCATAGGATTAGACTTAGCCTCTGCGGTGGAAGACTGTT
TCGGCGCAGTGGGCAAGCAGCACAAGAAGAGCATCAAGCTAAGTACTAGTGTAAGCAAGACCGCGAATTGATTGATGGAC
GAGGTCGCATATGCTTCAGCTTTTTGCACACAATGCTTGTTCAGACGCGCCGACAAAATGCGGTCAGACGTGGCATCCAG
CAGTGCCACATCCTCGATCTGCATGTCAGGCGAGACATACGACGAAGGAAGCGTCATTCCTTCGCACCCGGAACGGACAG
GGGAGGCTGTACGTGGATTAGTCAGCGGCAAGTAGGCTGAGACGAGACGAAAATATTTTATACACCAATCCACCCTATAG
AGTGAGTACTTGCACAGTTTGCATTCGTATACGCGTAGGCACGTAACGTATTATACGTCTTACATAAGCAGCGGAAGTTA
TGACAGCCGGACGTTTGTGCATTTGGGCAGCTCTGTGCATACGATTAGAACGATACGGTTGGGAAACCACGATCGACAAG
CACTTGGCAACCTGCCAGAACTGGAGCAGCGCAATGACGTATTTTACGAGTACTTTGTAGACCAGAGCTGTAATTTGCTC
GTATTTGGCAGCGGAGCCGTAAACTTCCCAATTGCGGTCCACGAAAAGACACTCTCGAATACGGAGCAGAATGGCACATT
CAGGCTTTGCGCACAGCCACAACCACGAGCGCCTATCGAAGACGCGGCGACGATGGACGGCTACGAGTACTCGTACGCCG
TAAGCGAGCTACGGGTGCTGCCCGCAAAGAGCGGGCGACGTGCATGCGATATCGCATGTTTGAAGTAATAATAGCTACTG
CAGCTCAAGCTTATTCGCTCAGAGGCCGCTTGGCCACAAGCAGCGGGTCGGGCGGTGCTGGGAGGATCTAGAGGTGTGGA
CGACGGCAAGGGAGGATGGCAGCAGTCCGTCCCGTTAATCTTACAGCAAGCCGGACCGTCATCAGCCTCACCAAGAGCCC
CAGGCGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62