GenePrediction:GLEAN_3731 Details

Name: GLEAN_3731
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:550473..554273 (+ strand)
Length: 3801
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:550473..550566 (+ strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_113:550618..551274 (+ strand)
Length: 657
Type: CDS
Source: GLEAN
Position: GCSC_113:551481..551584 (+ strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_113:551643..554273 (+ strand)
Length: 2631
>GLEAN_3731 class=GenePrediction position=GCSC_113:550473..554273 (+ strand)
ATGGCTTCTCCCAGTGAGTACGAGCAGCTGACACGAGACGTGTCTGGCATCCTGTTGTTGCCGCTTCCTCCGAAGGCGGT
GCAACACCCGGCCAGTCTGGCCCGTATGCTGTCCTATTGCCGGCGGCCTTGCTGACAAGACACAGTGCCGGCACCCACCA
GTGCTCCTCCTCCGCCTCCTCTCACTCACAGCTCTCCCACGCTGCCTCCCGGCTATGAGTACGATGACCTTTCAGTGTCG
GACCTAGTTGGAAGCCTGTCCCTGTCGTCGGCACCACAGCTTCCTCCTCTTGATTACTACTCCAGTCCGGAGCAGCAGCA
GGAGCAAGAGCAAGAAGAACCAGGAGAATTTGACGAACAAGACGAACAGGAAGAACAAAAACCAGAAGAACGACAGGCGG
TACCGAAATTCCCCGAAGACTACCTGCCGTCGCCTACTCGCTCGGCACCGGCACCACCTCTTCCGTTCGAACCGATCCTG
ATCGGGCCCCCCGGCCCCCAGAAGAGGCACCAGCTGCACCAGTTATGTCGCCGCCATCGCCGCCACCTGCTGTCCAGACA
GAGGGCCCGACAGTGCTGCGTAAGACTCGGGGCAGTCAGGGATATGTCAGGGCTGTCGGAGGAAGCGGCCCGCAACAAGG
CACCGAGGTTCAATGCGGTCTCCGGGCCGCTGCACCTGTTCAAGTCGCAGGCTCGCGGGCGGTCTCCATCGGAAGCCGAG
AAGCCGCGGGGACGCAGCGTTTCGGCGCAGCCGCCAGAAACAGGCACCCAGTCAGGCGCTCAGCCACACGCCGGCACACC
TCGTTTCGATCGTCGGAGGCAAGACGTCCCCGTTCCCATTCAGCACATTCCAGCGAGGGTAGCAGCGCCAACAGCCTGCA
TGCGAGCCTCGCGACGGCAGCCCTTCGGCGTCGCAGCTGGCTGCCCGGCAACGGCAGCATCAGCAGTCTCGGCAGCTTTG
GCGGCCTTGGCAGCCTCAGTGTCAATATCAGCAGTGCACGGTCGCGAGCAAGCTCAAAGGGACCGCCGCCACCGCCGCCA
GCAGAGGCGTGGGTGCTGACGGCCGACTCGACGGCCGAGTACAACGTGGAATATTTGCTGAGCAGAGAGAGGGTGAGTTC
TGATTCTGGTTTTGGTTCCTTCTTATTGAAGCTATGCTGACTCTCGACAGGTGCCTGAGCTCTGGGACGAAGGTGGCACA
CTTTTTATCTTCCTGGCGCCACGCGACAGCGGCAAAGAGGCGTCGTTCCGGGTGCGTGCATCGATCATCAGTGAGAGTCC
GGTGCTCATCGGCATGGCGCTGGCAGAAACAATGTCGCCAGTCAGCATACGTTCGCCAGCGCGCAGCTTCAGTGGACGCG
ATTCGCTCTCGGCAGCCGACGCCCACCGGATAGTGTCACCGGGATCTCCGGCCGATTCGGACATGGGCGATGCGATGGCG
CTGTATCTGCCGGTGGTCAGCAGCAACCCGGGCGAGCGGACGAGCGAGCTGGAGCAGCTCCTGCCGGTGCGCAACCTCTT
TGCGCTGCTCACGGGCCAGCCTCTGGTGGCTACACACAGCACGCCGACGGCCTTCTCGGTTCTGCTGCAGGTGGCAGCAC
TGCTGCGGGAGTTTGAGTTTGGAGTGGGCAGCAGCGCGGGCAACGGGTCGTTTGGCAGCAGCGGGTCGTTTGGCGAGGCC
GTGGACCTGTGCCTGGGCTTCTACCTGGAGCGGGAGGGTCTGATGGACGTGCGGCACAGCCGAGAGAAGACGCTGGAGGC
GCTCGTGCTGGGCGAACAGCTGCGGTTCTGGCCGCTGTACAACGAGGCGTTCTGCCACGCCGTCGGCAAATACCCGGCGA
TGCGCGAGACGCTGCGAACGTCGCCACTGTGGCAGCAGCTGTCGGGCAACACGCGGCTGCGGCTGGAACGAGCCCATCTC
GATCTGCTCTCGCGACAGCACAGCGTCAACATGCGGATCGAGCAGTTTGATTTTCCCAGCCTGTTTTCCGGCACCGGCAA
CTCCACCTCCAACGACGCCTACCGTGGACTGCGTTTCAAGAACTGGCGTACGTCCTTTGCCGACATGCGTTCGTTTGTGC
TGCGACACTACAAGTCGCGTTTTGGCAGCTGGCCGCCCAAAGCGAGCAGTCGGCGCAATCCCTTCAGCGAGAGCGGACTC
AACCGACTCGTCCTGCGCACGCTCTACACCGATCTCTGCGCCGTCTACGATCTGTTGGTCGACCGCTCGTCCTTTACGCC
GCGTGTCAGCGAGGACAACGCCGTGGCCACGTTTGCCGTCCCACCTGACAGCGGCCTGGCTCCGGCCCACCATCACCAGC
ATCCACATCTTCACCATCGCCATGCCACCAGCACGGCCTCAACGGCGACCACGGCGACCACGGCGACGAGCTCAACCTCG
ACCTCGACCGCGGCCACGCCCACCTCGGCCTCTCTGGCGGCAGCCCGGCTTCCCGAGATCGAGAACGCGATGATGGCTCT
GCGGCAGATCTTGGCCGAGTTTGACGAATCGTCGCCGCCCGTGCTGCCACCCATTCCCTACGATACGCCACTGCTGCCGT
CTATGACTGCCGTCCTGCCGACGTACGGCGAGATGTCGGCCAGAGACCAGGCGCGCTTCGACCGTGGCATCAAGGAGGCT
CAAATGCAGTCAGTCCTGCGCATGTCGCACAATGCCGACGCTGACTGTCCGGACTCGTCGACCTTCCTGGCCGCCTTTGA
AGCCTTTGAGCTGCGCGAAGCCCGTCGCGGCAAGTCGGGCGCCGAGCTGGCCGAGATGCGCATCGGTCACTGGCTGTTCC
TGTATGTCGTGCTGCAGAGCATGCCCATCCTGGTGGTCGACGCTCCGGGCTTGAACCACACCGACGGTGTCGAGTACTTT
CTCTGTGAGCCGTCGCAAGGCCGTCCGCCCTGGGTCGAGGATGCCGGTGAGGTTCGCAAGGCCTGGTTCCAGACCGCCGG
AGGAGCCGGGCCGCTGGTTGAGCTGTCGGCCGACGTGCTGCTGTATTCGGTCGAGGCCACGTACCACCGCTCGCACTGCT
GGCTGGCCGCCCAGAAATGGCTTGGCGACGCGAGAACGGGCAAGGGATTTAACTCTGGCGCTGCCGGAGCCGAAGCCGGT
TTTGTGCCGGAACCGCCCAGCAGGATCGAGGCAAACGACGATGCCGACTCCGACTTTCACATGCCGGATCTGCCGCGGCC
CTATTATCTCGCCGGCTCCATGTCTGTTCCGGACTTGCCTCGCTTTATCGACTCGGGATCGCCTTTGGAGCCGCAGTCGG
CCACGACCACCTCATACTCCGCCTCATTCGCCGCGCCGCTCGATCTACCGACGCCAACCTCACCCCAAGACCGGTCCGGC
AGCCCGGTGATGATGTCCCGGACCAGCACCGACCCGCTGCCCAACATACAGCTGCAGGTGCCGCGGCAGCGCGCAAACTA
TGGCGAGCTGCAGGAACGCGCCAATCTGCGACACGCCAGCATCGGCTGGGCGCTGGAACCGGTCAAGATCAGCGATGTCG
ACATGCTTCCGCTGCAGCAGCCGCAGCAACAAGAGCAGCTGGACCCGGAGCCGCTACAGCAGTTCCAGCAGTCTCAGCAG
CTACCGCAGCTACAGCAGCCGCAACAGCGCGGCCTGATGGTGCCTCCACAGGCACGGCGCGTTGCCTCGGCCGGCAACCT
GCGCGTGAATACGGGCAGCGATTCCCTTGTCAACACGGGCAGCACGTTTGACGACATCCTGGGTGGCATGGACAAGACGG
AGAAGAAAAACAAACGGAAGTCGTTCCTCCCATTCATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62