GenePrediction:GLEAN_3734 Details

Name: GLEAN_3734
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:571004..572932 (+ strand)
Length: 1929
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:571004..571167 (+ strand)
Length: 164
Type: CDS
Source: GLEAN
Position: GCSC_113:571231..571275 (+ strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_113:571522..572932 (+ strand)
Length: 1411
>GLEAN_3734 class=GenePrediction position=GCSC_113:571004..572932 (+ strand)
ATGGCGCCAATTGATGTTGCTATGGCCCGGAGCCTGCACCACCGAAGCGTGCTGGACGTGTTGGCTGCTGCTGTATACCC
AGTAGTCTCCCGGCGAGACTCGATAAGCGACGTCAAGACGGCATTTTCGAGCTGGGATAATTGCATGGCGACAACCTACT
GCAAGTAAGCTTCCCTCTAGATGGCGCCTATCTCTCTGGGTGTGCTGTGCTTACAATGTCTTCACAGGTGGCCCGTGATT
GCAGTTATCATCATCGCAGGCCTGATCATTGTGTCCGTCATCTGGTGTATAGCTCGTTGTGCCTGTTGCGGGCTGTCGTG
TTGCTGCGAATGCTGCTACTGTCTCAAGTGTTGCGGCGACTGCTGTGGCTGCTGTACTCCACGCCGAAAGAATCATAAAT
ACCTCGACGAACCCTTCATTCCGCCAAATCAAGGCTACCAGTCCCAACCCCAGCCCCAGATCCCGCCCCAGATTTTGAAC
CAAAACTTTCAACCACAGCAACAATATGGGGTACAAAGTACGGGATATCGCGCCGAAGAGCCCATGATGACCGGAGCAGC
ACCGAAATCCAGGGCACCAGTGAAGGATGTCCCCCAGTTCGCCACATTCGAGGTGACCAAGTCGGAACCCGTCGACGAGG
ATGCGCTTCCCGCCATGCCCAGCTGGGAGGGTGCCAACCATACAAAGGTGCTCATGGAGGAGGACTCTGTCGAGCTGACG
GATCTCAAGAAGCCAGCCCCAGCTGGCCAGAGCGTGTCGCCTGTGAACGGATTTCGCGGCTCTCCCGGCGTTGTCAGTCC
CGGTCCTGGGGGTGGTGCCAACCCGTACGGTGCGTATGGTAGGCCATTAGCGGCAAACAACCTGGGCGGCAGCCATGCTG
CTGTGGCGAACGGGTACATGGCTGCTGGAGCCATTCCGCGCTCCACAGGGCCCGGCGATCAAGCATATGGCCAGAACAGC
CAGGGTTACAACCAGAGCAACCCAGAATACGGCCAGAACATCCAGGGCTACAACCAGAGCAACCCAGATTACAGCCAGGG
CAACCAAGGGTACTATCAAGGAAACCAGGGCAACCCAGGATACGGCCAGAACGGCCTTGGATACGGCCAGAACAACCTGA
ACAACCGGGGATATAACAACGCAGACATCAGCCGCCAATACAGCGCCTCTGATTATGGTGACACGGGCTTTGACCAGCAG
ACGATGATATCAAGACACCAGACACCGGTACAGTCTCCGCTCGGTTATAGAGGCCCGAGCCCGGGACCTCAGCAAGCCTA
TGCACGCAACATGCAAGGTAACGCGCCGGGCAACATGGGTGCCATGGGCAACATGCCAGGCAACGGTGGGTACGACAGCT
TTGGGCGCAACGCCACGTCCTCTCCAGAGCCATTAGGCTATGATAATCTGGATCGCCGGACGCCGCACATCCCGGACATG
GGTCTGAGTTACGGTGCTCCCGTCAGCCCAGTGGCCGCCACGGGTATGGAGCCGACGGAGCTGTACGGCGGGCCGTCGTC
GCGCTCGCCTCCCAACGGTTTCAACGACCCCGGCCCCATCGGCCTCGGTGGTCTTGGCGGTCCCAATGGCCGTTCCCTGG
ACAGTCGGTCACCACCCGTGCAGACATATGCTCCTGCAACGAGCACCAACAACTACGGCGGCGCCATGAACAGCAACCAG
GCTGAAGTCTATGAGATGCCAAGCTCGCCACCGAGTAAGAATAAAACTGGTGACTTTGACTTCGGCCCGGCTTACAGCCG
GCCAGAAGCACAGGTCCAGGATCCGTACAACACCAGAAGCAACGGCTACAACACAAATGTCAGTAGCGACGAGATCCACG
GATACACCAACACAGCCAGTCCGCCACCACTGATGCAGCCACAGCCACGGCAAGCTGCATACCCCGGATACCGGCCATAC
CAGCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62