GenePrediction:GLEAN_3735 Details

Name: GLEAN_3735
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:577132..577942 (+ strand)
Length: 811
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:577132..577259 (+ strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_113:577334..577514 (+ strand)
Length: 181
Type: CDS
Source: GLEAN
Position: GCSC_113:577583..577942 (+ strand)
Length: 360
>GLEAN_3735 class=GenePrediction position=GCSC_113:577132..577942 (+ strand)
ATGGATATCAATGACATTCTGCGCGAGGTCGACCCGAGCTTCGACCCCATCGGCAGCACTGAGATCGAAGACCTGCAAGC
CCTGACGCGTGCCTGGGTTGCAGAACGTTCCGCACCCGAACTCCTACCGTAAGCCGTGGTGCCCATGCTGCAAGAGAGAC
AGACGAGTACCGCATGCTGACGACGCATATCTCTACCTGCAGGTGGCCCGTCGATGGCTTGTTTGAGCGTGTCAGCCAGC
GCATCAAGCGCCAGATCGAGACGGTCGAGGAGCTGACCGGCGACATGGATCCAAAGACCAATTTTGCGCTCATTGTGATC
CAAACGGAGCTCGAACGCTTCAAATATCTTGTCCGCAGCTATCTGCGTGCGCGAATTGCCAAGGTCAGAGCTGGAGAGGG
CGTGGTGCCTTGTGTGTAGGACTGGACGTCGACACTGACAAGGCCTTGCAGATCGACAAGCACACGCTCCACTACCTGTC
GACTGCGGAGATGCGTGCGAACCTGTCCGAGACGGAGCTGGCCTATGCGACTCGGCATCAGGCCCTTCTGCACAACCACT
ACCTCTCATCCTTTCTCGCCTCCTTCCCCCCACCGCTGCAGAACCTTAACGACACGGCCGGCAACATTAGCATGATCGAC
AGCCCCGATCTCGACACGGCCGTGTTTGTCCGCCTGCTTCGGGACACCCTGGTGGAGGCCCATGGTTCCGATGCCGACAA
TATCGTGCGAGGACTCGCCGGCGACGTCCTCATTTTACGCTGGTCGGATGCTAAGCTCCACGTGCAGTCTGGAGATGCGG
AGCTGGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62