GenePrediction:GLEAN_3738 Details

Name: GLEAN_3738
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:584106..585975 (+ strand)
Length: 1870
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:584106..584225 (+ strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_113:584290..584581 (+ strand)
Length: 292
Type: CDS
Source: GLEAN
Position: GCSC_113:584644..585428 (+ strand)
Length: 785
Type: CDS
Source: GLEAN
Position: GCSC_113:585487..585975 (+ strand)
Length: 489
>GLEAN_3738 class=GenePrediction position=GCSC_113:584106..585975 (+ strand)
ATGCGTATCAACTCTGTTGCCGCTGCCGTTGGTGCAGCTCTGCTGGCCCAAGGCGCATATGCCGAGGACACCAAGGAGGA
GACTGCCTCGTCGGTAGCCCCCCAGGCGCCCACCTTCACAGTACGCATCCTTTCCACCTGTTCTGCCTCGTCTCGCGCAT
TGCTGACCTGACCCTTCCCTCCAGCCCTCCAGCATCAAGGGTGATTTCGTCGAGCAGTTTACCGACGATTGGGAGGAGCG
GTGGAAGCCTTCGCACGCCAAGAAGGACACCAAAGGCTCCGAGAAGGAGGAGGAGGAGTGGGCATATGTCGGCGAGTGGT
CAGTCGAGGAGCCTTCGGTGTACAAGGGCATCGAGGGTGACAAGGGCCTGGTCGTCAAGAACAAGGCTGCCCATCATGCC
ATCTCGGCCAAGTTCCCCACACAGGTCGACAACACGGGCAAGACCCTGGTTGTGCAGTACGAGGTCAAGCTCCAGAGTAA
GCTTTTCCCCACAGCGACGAGGAGAAGGGCGATTGGTGGATGAGCTAACCCGAAACAGACGGCCTCGAGTGCGGTGGTGC
GTACCTGAAGCTTCTTCGCGACACGGAGGCGCTCCACCAGGATGAGTTCGCCAACACGACACCGTACGTGATCATGTTCG
GCCCCGACAAGTGTGGCCACACCAACAAGGTGCACTTCATCTTCAATCACAAGAACCCCAAGACGGGCGAGTATGAGGAG
AAGCACCTGAACAGCCCTCCGTCTGCCAAGATTGTCAAGACCACGGAGCTGTACACGCTCGTCGTCCACCCCAACAACAC
GTATGCCATCCAGCAGAACGGCGAGACTGTCAAGGAGGGCAGCCTTCTGGAGGACTTCACGCCGGCCGTCAACCCGGCCG
AGGAGATCGACGACGCCGAGGACAAGAAGCCCGAGGACTGGGTTGACCAGGCCCGCATCGCGGACCCGGAGGCCACGAAG
CCCGAGGACTGGGACGAGGAGGCACCGTTTGAGATTGTCGATGAGGAGGCTACCATCCCCGAGGACTGGCTCGAGACCGA
GCCTCTGTCGGTGCCGGACCCGGAGGCTCAGAAACCGGAGGACTGGGACGACGAGGAGGACGGCGACTGGATCCCGCCTA
CCGTGGCCAACCCCAAGTGCGCCGAGGTGTCTGGCTGCGGACCCTGGATTCAGCCCAAGAAGAAGAACCCCGAGTACAAG
GGCAAGTGGAACGCACCGCTCATCGACAACCCGGCCTACAAGGGCGTGTGGGCCCCCCGCAAGATCAAGAACCCCGACTA
CTTTGAGGACAAGACGCCGTCGAACTTTGAGCCCATTGGCGCTGTAAGTGGCACCGTCGATCATCCGTCTTGTAAGACAC
GCAGTGACTAACAGTTTACAGATTGGCTTCGAGATTTGGACCATGCAGAACGACATCCTGTTTGACAACATCTACATTGG
CCACTCGGTGGAGGATGCTCGCAAGTTTGCCGAGGAGACCTACTTCCAGAAGATTACGGTCGAGAAGGCGGTTGAGCAGG
CCGAGAAGCCCAAGGCTGAAGACAAGCCCAAGTCCCTGGCCGACCTGAAGTTCACGGAGGACCCGGTCACGTACGTAAAG
GAGAAGATCGACCTCTTCATGACGATCGCGGCCAAGAACCCGGTCGACGCGATCAAGTTCGTGCCCGAGGTGCCGGCGGC
GCTTGGCGCGATCCTGGTGCTCCTGATTGGCGGCATTGTGGCCCTGAGCATTGGCGGAAAGCCGGCGCCGGCACCGAAGA
AGAAGGTGGAGACGGAGAGCAAGGGCAAGGACAAGGCGGAGGCGTCGACCACGGGTGCGGACGCGAGCAAGGAGGGTGTG
ACCAAGCGCACGACGCGGAGCCAGTCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62