GenePrediction:GLEAN_373 Details

Name: GLEAN_373
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1359117..1360418 (+ strand)
Length: 1302
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1359117..1359333 (+ strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_167:1359394..1360418 (+ strand)
Length: 1025
>GLEAN_373 class=GenePrediction position=GCSC_167:1359117..1360418 (+ strand)
ATGAGTGCGTCGCCGCTCCTCGCGATCCCGACCGACACGCTGCACAAGTCGACCTCGCCGGCGGCTGCGGTGCGGTCGCC
GTCGGGGCTGCCGTCGCGGCCGTTGACAAACGACAGCATGGCTGCAGGAGGACGTGGGACAGCGCCAGCACGACGAGCCA
TCCCGATGGACGTGGCCGAGCGGCTGAACGAGGAGGAGAAGAAAAAGTACATCAAGGGTGGGTGTCTACTCCTGTCTACT
CTACTCCTCCTATCTTCTCCCCTGCTAACATCTCCAGGAAAGGAGCTTGGCGAGGGCACGTACGCGGTCGTGTTTGAAGG
CCGTCTGCGCACAGACCCGACGCAGCTGGTGGCCATCAAGAAGATCAAGGTGCAGAAGGAGTACAGCGACGGGATCGCGC
CGGATGCGGTGCGGGAGATCAAGTTTTTGCAGGAGCTGCGCCACGCCAACATCATCCGGCTGCACGGCGTCTACAGCACG
CGCGACCAGAACCTGCATCTGGTGCTGGAGCACTTGCCACGCGGCGATCTGGAGATGCTGATCCGCGACACGGCCGACAT
CCGCTACGGCGCTGCCGACATCAAGGCCTGGATGGGCATGTTGTGTCGTGCCGTCGCCTTCTGCCATGACCGCGCTGTGC
TGCACCGCGACATCAAGCCCAACAACTTGCTCGTCGCTGCTGACGGCGCCCTCAAGCTGGCCGACTTCGGCCTCGCTCGC
GCCTGTGCCGATCCCTATCGCCCCATGACCGCCAACGTGATCACCCGCTGGTATCGCCCCCCGGAGCTGCTCTTTGGCGC
TCGCCACTACACCGGCGCCGTCGATGTCTGGTCGGTCGGCCTCGTCTTCGCCGAGCTCGTCATCCGCAACCCCTATCTGC
CCGGCAATACCGAAGTCGAACAGATCGCCCTCGTCTGTCGCGCTCTCGGCACCCCGACCGAAGACAACTGGCCCGGTGTC
TCCCGCCTCGACGCCTATGCCGTGCCCACCGATCGCGTCTATCCCGTGCCTACGCGCGACGTCTTTCTCGGCCCCTTTGG
CACCGTTGGCCCCGACGGCGTCGATCTTCTCATGCATTCCCTCGTCCTCGATCCACGTCGCCGCATCTCCGCCCGCGGCA
TGCTCCAGCACCCCTGGTGGCACGTCGACCCACGTCCCACCCCCATCCAGGACCTGCCTCGCCGTCATGTCCCGTCCGAG
AAGGACCGCGAGCGCATGGCTGCCGATCTGAAGCGGCGTCCGGGTGTCGAGGATGACCGGGGGGCCAAAGTAGCCCGACG
ACTCGATTTTGGGAGGAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62