GenePrediction:GLEAN_3742 Details

Name: GLEAN_3742
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:607829..608870 (+ strand)
Length: 1042
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:607829..607965 (+ strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_113:608037..608203 (+ strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_113:608269..608870 (+ strand)
Length: 602
>GLEAN_3742 class=GenePrediction position=GCSC_113:607829..608870 (+ strand)
ATGTCAAAGAGACAGAAGCGAGAGAGCTACCTGCTGGCGCAGCAGCGGCCTGACGGCGCCGTGCCGGAGCTTCCGCAGAA
GAAGTTTTACCGGCAGCGAGCCCATGCGAATCCGTTTTCCGACCACCAGCTGGTGTAGTGAGTTGATCCTGCTCCGTCTG
GTTGTGGTTTCTGTCCGAAGCACCTTCTGACCGAGCTTCTGCGTGCAGTCCGGCCAGCCCAGATGCGATGGATTGGGCGT
CGCTGTATCCTGACTTCTTTCCTGCTGCCGCCACGGAAGAGCAGCAGCAGCAGGTCGAGGTGGCCGACATTGGCTGCGGC
TTCGGCGGCCTGCTGGTCGGCCTGTCGCCGGTGATGCCGGAGACGCTGATTCTGGGTGAGCAAGACACGAACCAAGACGT
GTGGTCTGTCCGCATGGCGCGCCCGCTGACAGACTGGCAGGCATGGAGATCCGCGATCACGTGACCGAGTTTGTCCAGAA
CCGCATCCACGCGCTGCGTGCTCAGGGCCGAGAGGCGGCCGGCGCCGACGAGGAGACAACAACAGGCCCGTCTGCATTTG
CCAACATTGCCTGCGTCCGGGCCAACACGATGAAGTTCCTGCCCAACTTCTTCCGCAAGGCCCAGCTGCGCAAGATCTTT
CTCTGCTTTCCCGACCCGCACTTCAAGGCCCGCAAGCACAAGGCCCGCATCGTGTCGCCCACGCTCGCGGCCGAGTACGC
ATACGTCCTCCGGCCCGGCTGCGGCCGCGTCTACACCATCACCGACGTCGAGGACCTGCACCGCTGGATGGTCGCCCACT
TTGCCGCCCATCCGGCCTTTGCCCGCCTCTCGCCCGAGGAGGAGGCTGCCGGGGCCGAGGAAGAGGACGGACAGACAGGT
AAGAACGGAAAGGACGGAAAGGACGACACATCCGATCCCTGTATTCGCGTCATGCGCACCGCCACCGAAGAAGGCAAAAA
GGTCGCCCGCAACAAGGGCCAGAAGTTCGTCGCCGTCTTTCGCCGCCTCGAGGACCCGCCTTGGCCGACAGACACTTTGT
AG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62