GenePrediction:GLEAN_3745 Details

Name: GLEAN_3745
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:642249..644579 (+ strand)
Length: 2331
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:642249..642451 (+ strand)
Length: 203
Type: CDS
Source: GLEAN
Position: GCSC_113:642542..644579 (+ strand)
Length: 2038
>GLEAN_3745 class=GenePrediction position=GCSC_113:642249..644579 (+ strand)
ATGTCGAAGAGGTCTCGTGCGATCTACGAGGCCGAGCTCCAGGCGTTACAGTCCCCGTTTGTCTCTTTCGGCACGCCTCT
TCCACCCCTCGACGACGATGTGCGCGACGACGGCTCCTACGTCCCGGTCTGGAAGCAGGAGGTGAGGGATGAGAATGGGC
GGAGGAGACTCCATGGCGCCTTTACCGGTGGATGGAGTGCTGGGTAAGCTGGTTATTTGCTCGTTGCATTCTCCTTGCTG
CTGTGAACGTGTCCCTGCGCCTATGCTCTCGCTGCTGACAATGCCTGACATAGCTATTACAACACTGTTGGCTCCAAGGA
AGGATGGACCCCCTCGACGTTTGTGTCCTCGCGGGCAAACCGCCGGAAGGACCAGCCAGAAGCTGTGCAGCACCGCCCGG
AGGACTACATGGACGAAGAAGATCTTGTCGATGCCGAAGAAGCGAGGAAAATCCACACATCGAATGCCTTTGCCGGACTG
GGTCTGACCGAAGACGACACCGTCCGCGCCAGCTCGACAGGTCTTGCCGGCCTATTCCGGGTCCAGGGCGAAACCATGGG
GACACGGCTGTTGAAGAAGATGGGCTGGAAAGACGGCCAGGGCATAGGGCCCAAGGTGCGACGCGCCGCGCGATTGGATG
TCGGCAGGCCGGGGGATAGCAAGGGAACACACCTATTTGCGCCCGAAAACGTCGTTGTGGTGCGGCTGTTGAAGAAGACA
GACCGCAAGGGTTTGGGATACGAGGGAGCAGCAAGGCTGTCCTCATTGGCACCGCCGTCAAAGACGGCGAGTGGGCGGCG
TGTTGGCGGCGACAGTGACGAGGACAATGACGGCGACGACAGCGAAATGAGCGGCTTTCGGAGTGGCTCGTTTGGCCGAT
CGAAATCCATAGCGAGCAAAAAGACGGAAAAGAAGGGGCGCAGCGGCGGCATTGGCATGGGCGTGCTCAACGACACAGGC
TCCGATGATGAGGACCCTTACGACATGGGGCCACGAATATCGTTCAACCGGGTAATTGGCGGAGACAAGAAAAAGAAGAA
GCCGACACAGAAGAAGATTGGCGACGTCGATAGCAGCGCCGGGGTGGCCAAGTCCAAGTTTGCCTTTTCAAAGCGTCCTA
TGGCGCTTGGGAATACTTCTGGCAATGCCCGTTTATGTCATGACGGCCGACCGCCTCTGGCTGGCTTCGTGCTGGGACGC
GAGTCAGACGCGCTGACGTCCGATATGAATTCTGCGAGCAAATACCCACCACCGACGATCCCGGCCGGTTGGACGTCGTC
GAAGCAGGCCAAGAGTCGGCAGGCCAGCTGCAGCTACGTCTCTACGACCGATGCGGCGAAAGCGTCGAGCATGGACCCCA
AGGCGCGTGCGGCCGTGCTTGGCGAGGGCCTGCTGCCCGGCAAGTCTGTGTTTGACTTTCTGTCGCCGGCAGCACGAGAC
CGCATCGCCGCAGCGACGGGGAGGACCGACCTGCCCGAAGCCCGGAGCGAGGTGCCGGCCGAATTTGCGCTGTCCGACGC
GGAGAAGCTGGAGAATCTGCTCCAAGAGGTGCCGTCGCTGGATAAGGCCACCGCGGTGGCAGCAATCTCGCGAGGCGCCC
GTGGTGGCGGGCCATACCAGGACAACGAAGCCAAGCGGTCCCGATATCGTGCTTATCTCGAGTATCACGCCGGCATCGCG
AGTGCACTTCCACCGAAGCCGACCAAGCTTAGCAACGACGACTGGTTGCGGGAGTTTCACGAGTTTTTTAATTGCGCGAG
GATCTTTAAGCCCATGTCCGGCCTGATGGCTTCGCGATTCACGACGTCCTCGTCGGCGAAACAGCCATTGGCCAGCGGCT
CAAGCGGCAAAGCCGACGGCAGGACCAACCTGGTGTCCAGACCGCCGCCAAAGGCGCAGGATCCAGCTGAGGAAGCGGCC
AGCATGGGCATGTACGGACCTCTGACGCGGTCGGTGCAGGAGTTTTTCCCAACACGGCTGTTGTGCAAGCGACTAGGGGT
AAAGCCTCCGGCCATTGTGCAGCCAGACCAGGACGTAGACATGGACATGGGACGATCTGGCTCGTCCGCCTGGTCGTCAT
CTGCTACGAGCAAGCCCAGCTACAGTAGCACATATGTGCAGGGCAGCGCCGGGGTGGCTGGACAAGCGACTCCGGCAACG
GCAACGGCTGCGGTGTCGACGTCGAACACGGATGTAACGGACGCAAAATTGCCAGAGGATGCTTCGATCAGGACCAACCG
AAACGAAGCTCTAGAGGGTCAAAGGGCCAGCGAGGACGTATTCCGGGCGGTGTTTGGCGACAGCGATGACGATGATGACG
ATGACGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62