GenePrediction:GLEAN_3746 Details

Name: GLEAN_3746
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:644638..647235 (+ strand)
Length: 2598
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:644638..644657 (+ strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_113:644997..645365 (+ strand)
Length: 369
Type: CDS
Source: GLEAN
Position: GCSC_113:645436..646197 (+ strand)
Length: 762
Type: CDS
Source: GLEAN
Position: GCSC_113:646343..646478 (+ strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_113:646547..646890 (+ strand)
Length: 344
Type: CDS
Source: GLEAN
Position: GCSC_113:646950..647235 (+ strand)
Length: 286
>GLEAN_3746 class=GenePrediction position=GCSC_113:644638..647235 (+ strand)
ATGAGCAGATTAACGAGCGGGTGAGTAGAAGTGTGGGATGCCGCATGCAACGGTGACGAACAGCGGTTTCTTACTGGGAC
TCTTGGCAGTGATTGGCTTAGCTGGGGGACGGGCGGCTAACAAACCCCCTAATCCCTCGGCGCTTGGGGACCAGGAAAGC
ACGGACCGGGCAGACTAACGGATGGGGAATTAAGGGGAGAGAAGAGATGAGGGAAAGTTGAACGGCGGCCTTTACAGGAC
GATCGTAGTGCAGTGGACAGGCCCGGTAGCTCCTTCTGGGCCAGTGGTGATTTTGCCCCCATCCCTTTCGAAATTGCGTT
CAGAGACAACATAAATAAAAATTACGACTCGCAACGCAGCTCATCCGCAAAGGCCATCACCAACCAATCCGTCTCGGCCG
TGCTTCCTGACAGTGTCCTGTGCTCCCTGTCGCCCGGCAACTTCGATTCCTTGTCGACGCTCCCAAGTTTTCTGCCCTGT
CGCTTCTGTGGCCTGGCTCGATCTGCTCTAATTCTGTCCATCATCAGGTTCTTCCCAGATGACCGCCTGAATCAGCTCAT
TTCTTTTGTTTTGCAGACAGTGAGCCTCTCGGACTGCCCTCGTGCTGCTCGCGCCCTCTTCTCTGCCCTTCTCGTCACGC
GCGCCGCAATCTACGGACCGATTTGTGACGACATCCCCCATACACATGCTCCCAAGCATACAGAACGGCAACTACGACGT
TATTTGTGGTCTGTGCGGATCCATCTGAGGGAAGCAGGCTTCTCGCGCTCTACACGTGTGCTGTCGTCGACCACACAGCC
AAAGAACGAGTTATTTTCAGCAAAAGACCCCGAGCCAACCATCCACCGTGTCCGACCTCAGGCTTTCCAATAACTTGACG
GGGCCGTTGCTGTCCACCGGACACTACCCAGAAGAAGCCACCGCGGCTGTGACAGATTGCTACGCCCTTGCCATTGGCCG
ACGCTTTGCCAACGACGGAGAGATCTCGAGTAGCAGCGCCTCAAAGGCCGTTGCCGCCGCTGCCGAGGACGACGAGAGTG
TGGAGATAGAAGAGATAGAGGAACGAGGAAAAGCGAGTCTTTGCGCTAGGATCGACAGCCAACAGCTCAGTCCTCCTCCA
CAATATCCATCACCGGGGAGCTCCCGTGGCAAAGCCGAAGATACCGAGAATCAGGCGCTGCCTCCATCGACACAACCGCC
TCCGTTCAGCTCGATCATTGGAGCCCTTTCCAGCCCGACTTCGCCAGCAGCTGCACCAGCCTACGCCAGTAGTGCTTACC
AGCAAGCATCTTCATCTTCGTTCACTCTTCAGGAGGAAACTAAGCGAGCCCTACCTGCCGACACTAAGCGGCCAGGAGAA
TCATCGGGTTGCAGCAAGGACGACGACTCAGAACCACCACCAGCATACGAGGAGGGCTTCAGTCCGCTCCTTTCGTTTAC
GTATCTGATGGCGGCCGCCGGAGGAGCTAGTAGCATTCTCACGCAGGTGCAACAGGGGGGACCCCCGGTCAGCAACCTCG
GTGGTAAGAACGGCGCTCGATGGAACGGGTCCGAAGGCGTGTTCGATTTGTGCTGACAGACGGTGACATAGGCGAGGTAG
GTGTCGATGAGACGATCGCGATGGACCTTGGTTTTTCGTTATTTTTTTTTTTTTTTTTTTGTTTTTCGTGTCTCGAGAGT
ATGAACCAGGCTGACTGTCGTATAGGGGAACACGCTTTGTCCTATCAAGGGACGAGCTGCTTACGCTCCCCGAGTTTGTG
TTGCTGTCTCTTTTTCCGAACGGCCTCTTTCCCGAGGGCCATATGGGCGGCTTTGGAGAGAGTGATGCCATACACGTCGA
TGTATGTTTCACTCCCGCACGCGGACGAGGCACGGCGAGCCAGGTGGCTAACTCTGCTTATGTCTGTAGTACGATCCAGC
ATCTCTCCAGTACATGCTCGACTTCTTCCGCGGTGTAGCGCAGTCCATACCGTCGGATGCGCCCAGCGCGTCTCCGGAGG
GCGATGTGGGCGCGATTGACCCGCTGGCCAACCGAGAGGATGCGTCGAGGCGGGCTGGGATCATCGTGCTACGCGAGGAC
CTGGACTTTTACGCGATTCCGCCGCGGGCGAACATGCAGCAGGCGGAGATGATTGAGGTCAAGCGGGCGGCTGCGCAGGC
TCTGCTGAAGCAGAACGGGATATTCTCAGGCCTGAAGCGCAGCGACGAGCCGGGCACGACCGAAGCACATCTGATCGAGA
TGCTCACGGCAGGGTAGGTTCACTTGTCTGATACTCACCTGTCACTTCTCGTAACTACGCTGACACTAGCAGTGGATTTG
ACCACGACGATGCCTGGGGCCATCGTGCTGGCGAGCCGAACAAGGCAGTGATCTGCAGCCTGGCGCTGGCACGACTGCGG
TCGGACATTCGCGGCAACGAGATGAGCAGCAACGCGGTGGGCATGGCGCAGAAGCTGCTGCTGTTCTGGCGGAAGCCGGC
GCGTCGCTGCTGGTGGGAGGGTGTCGATCTGGAGGGTGTGGAGGGCGTGGAGGGCACGCTGAAGGTGTGGATCAGGCGGG
TGTGGACGCTGGAGATGAGCGTGATAGGGCTGCGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62