GenePrediction:GLEAN_3747 Details

Name: GLEAN_3747
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:648810..649856 (+ strand)
Length: 1047
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:648810..649856 (+ strand)
Length: 1047
>GLEAN_3747 class=GenePrediction position=GCSC_113:648810..649856 (+ strand)
ATGGCCAAGCCGACTGTGCTGCTGGTCGAGTCGCCGTGCCGCGAAGTCGACCCTGAGCAGTGGGCCCGCGTGCAGAACCG
CTTCAACCTGCTGCACTACGACTGCGACACGGTCGACGAGTTCTGCCGGCGACTGGCGCCGGGCGGTGCCTATGCGCACA
TCGACGCCATCGTGCGTGTCGGCTGGCTCAAGGCCGGGCCTTATGCGACGCACCAGCTCTTCTGTGGCCGGCCAGTCGGC
CTCTTCCCGACCTCGTTGAAGCTGATCTGCTGCACCGGCCACGGCTTCGATGCGGCCGACATTGCCGGCCTGTCGGCACG
CGGCATCGTCTATGCCAACGCGCCCGACACCTGCACCGAGGCCGTGGCCAACACGGCCCTCTTCCTGGTCCTCAACGTCT
TCCGGTACTTTTCTCTGGCCGAGCACGCCGTCCGGGCTGACCGCTGGTTCGACAGCCGCCAGGTCGGGCCCGTGGCTATC
GATCCTGTCGGCCAGGTTCTCGGCATCGTCGGCATGGGCGACATTGGCTTGGCCATTGCCCGCAAGGCAGCCCTGGGACT
CGGTATGCGCATTCACTACCACAACCGCAAGCCGAGACCGGCGAGAGACCTCGAGGGCCTGCCCGACGGTGCCGTTTACC
ATGCTTCGCTGGACACGCTGCTCGCTGTCAGCGACTGCATCTGTCTGGCCTGCCCGCTGACCACGGACACGCACCACATG
CTCTCGACGGCGCAGTTTGCTCGGGCCAAGAGCAGCGGCCTGCGGCTCGTCAACATCGCCCGCGGTGGTCTCGTGGACGA
AGATGCCCTGCTGGCCGCCGTGCAGGCAAAACAAGTCGTCGGTGTCGGTCTGGACGTTCATGCAAATGAGCCCGACGTCC
GGCCGGAGCTGCGGGCCAACTACTGGACCACATTGCTGCCGCACATTGGCGTCTGCTCGCGCACGAGCTGGCTGAACTTT
GACCGCCAGGTTCTGAGCAACCTGGAGAACTACTTTTACGGAGACAAGAAGACGGTCACGGCCGTGAATGCAGAGCTCCT
AGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62