GenePrediction:GLEAN_3749 Details

Name: GLEAN_3749
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:670681..672228 (+ strand)
Length: 1548
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:670681..671245 (+ strand)
Length: 565
Type: CDS
Source: GLEAN
Position: GCSC_113:671528..672228 (+ strand)
Length: 701
>GLEAN_3749 class=GenePrediction position=GCSC_113:670681..672228 (+ strand)
ATGGAACGAAGTCGCGGCGTTTGCAAATGCGCCACATACGAGGATCTCGCAACGCAGCAGAGCGAACTAAACCCAAGTAT
TGCTGATTTAGCCCGCTATCTAGGCCAGCAGCCAGCGCAGTCAAGTACCATGATTTCTTTAGATTACTTGTGTGGCGACC
AAGCATTGGCAGAGTCAAAATACATAGGCGAGAACGATTTGGAAAAGATACTCGATGGAATATTTGACGGAGACGAGCAG
CGTCACGTTATTTTGGTCGAGGATATCGAGCCCCGCCTAATCAGTCTTCTTGGTGAGAAGCTGGACATCGACCCTGTTTT
TTTCGCCGGTCATATTACCACGAATTTTGGCGACATAGAGCACGTGCCTCCTCCTCCATCTTTGGCCCTGCTTCCGTCAC
AAATAGCTGCGGCAGAGTATCTACATACGCATTACCAGAGGGTGATGGACCTGGGAAATGCAGACCTTTTCCAAGGCGCT
GCATACGCTTTAAAGACAAACTCTAACATTGTTCGGAACGTCCGCCGGTTGCCAGCTCTGTCGGGGAGGCAGCTTGGCCT
CGCCCGTGCTTGCTGTTCTGTTCATTTGAAACGACACAAAAGCTCATGGATTTGTAATTGTTCTGGTTTCCCCATACACC
TCAGGTTAGACCTAACGCTGATAGGTCTTATTCTTGTCGACCCTCCCATTCGGACGGTTGTGGACAGACCCAAATCTGGT
TGCAAGGTCCACTATGCAAGCAAGCCTTTACATGGTGGATTTGAAGACTTTGCGCGGACTTCACCGTTCTCCTCTTGCAA
TAACGCAGGTAACGCGGCAAGAAACGACACGCGTTCTTTACTTACAGACCTCGTCCGTTATCTTCGCTATCAGCCGCCGC
CTGGCTTTACAGTGGCTAATCCAAGCCTCCTAAGCCTCTGCTACTACCCAATACGCATTAGCCTGGCAGAATGGAACCTC
TACATCCACCTGACAAGCCGTTGCGTCAAGCACTATGAATACACCCTCTCTAGTGCTCAAAACCGGCTGCACGACGACGA
CATCAAGGACCTACAGCGCTGGAGGCGCCGCAGCAAACAGAGCCAACACAAACTTCTTCTTGTAGAGGCATTCGTTGACC
ACTGGCGCCAGCAGGAGGCAGACGGTCGGCCGACTTGGGACATGGCACTCATGGATATCCGGTATTTGCGCCAGCAGCTC
GAGCAGTACAGCATCTCATTAGAGCAGATGATCAGTGTGGCGACGTCTATGGTGCAGCTAATCGACTCACGGCGCTCGTT
GCAAGATGCGGCAAACGTAAAGCAACTAACTTTAATCGCTCTGATCTTCGTCCCTCTCTCGTGGGTGGCAAGCCTTTTCA
GCTTGTCTGACAAGTATGCTCCGGGGCACGAGAAGTTCTGGGTCTACATAGCCACAGCGCTATCTGTCCTCTTCCTAGTC
CTGCTCCTGTCAGCTCTACGATACAGTCATGTGGAGGGCTTTCTGAAGAGTAGCATCGGACGGTTAAGTCTAATCCGGAG
AGTGAAGATCAATGCTGGACCAGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62