GenePrediction:GLEAN_3751 Details

Name: GLEAN_3751
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:684810..687875 (+ strand)
Length: 3066
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:684810..684920 (+ strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_113:684974..685104 (+ strand)
Length: 131
Type: CDS
Source: GLEAN
Position: GCSC_113:685157..685198 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_113:685257..685320 (+ strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_113:685374..685414 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_113:685469..685558 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_113:685615..685963 (+ strand)
Length: 349
Type: CDS
Source: GLEAN
Position: GCSC_113:686012..686096 (+ strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_113:687058..687133 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_113:687197..687292 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_113:687662..687875 (+ strand)
Length: 214
>GLEAN_3751 class=GenePrediction position=GCSC_113:684810..687875 (+ strand)
ATGGTAGTAACCCACAGTCCTGAAACGGCACCGCATGTTGTACCCGCCGCTGGCGCCAGAGCTGACGAGCTTCAGCCCGG
CCATCACTGGACTGGCCAACCCTTGATTGAGGTAAGACAATTCTACGACTCTGCATCTGTGCGGCACTCTGACCAGTCGT
CCAGGACGACACCGACTCAACACTGGGCGACGATGCGGCCAGCTCTACTGCGTCCATTGCATCGACTATCCTGCGGTACA
GGACCGTTAATGGCAGGACTTACCACAGCGATAGTATCGCAAGCAATTCTTACTGGTAGGTAAGACCCTTTGTGTTAGAC
TGATTGGTTGTGTGTTGACTTTTATAGGGGCGCCAATGATGATGCCCAAAACGCTACGCTGGATATACAGTATGTCCAAG
TCAATAACTTAAGTGCTATGTAGCATAGCATAATGACATTTCTTTAGGCATCATGTGTTCGACCTACTCTTAGGCGGGCT
CTACCTTGCACCCTTGCCGAAAACACTCGATGTAAGCTGTGTGTATAGCACGTGTATGTCAATTTCAAGCTGACTATTAT
ATAGAAAGTAGTTGATGTTGGAACTGGGACGGGATTCTGGGCTATGTAGGCACCGATCCTCGCATAGTGGACGGAAGTGG
TGGCTAACAAATGGCTTAGTGATTTTGCAGACCAGCACCCTGAAGCCACGGTGATTGGCACCGACCTGTCTCCCATTCAG
CCAAAATGGGTGCCACCCAACGTGCACTTGTAAGGGCCATTTTGCCTTGATCATGCTTACGGCCTTAGGACTAATATAAT
TGCAGCGAGATCGACGACATGACACAGCAGTGGACATTCGAAGAGGACTCTATCGACTTCGTCCACGGACGTTGGCTGAC
TGGCTGTGTGCCTGATTACGCAGCCTTGTTCAAGGAGGCATACCGTACCTTGAAGCCGGGTGGCTGGATCGAATCTATTG
AATGTAACGCCTACCTTGAGACTGACGACGACTCCATGCCAGAGGACTCGGCTTGCGCCCAATGGGGCTACATATTTCGG
GAGGGCGCCAAGAAAATGGGCTCTACCGTCTCCTTCAGCGTTGTTCGCGACAAGCTGCAACGAAAGGACTTAGAGGCGGC
AGGCTTTATAAACATCCAAGAGCGTCCGCTAAAGGTCTGTTGTTTCCCCCTTCTTATGACCTTTTTAGCTAACATCCGGC
AGAACCCTATATCAGAGTGGTCGAAGGACCCAAAACTAAAAGAGATAGGCCAGTTTACCCGACTCGCATGGGAAAACGAC
CCGGAGGGTATGGTGGGCTTTATGGCCAACTTGATCGGCTGGTCAAAGTCTGAAATTTCCGTGTACTGCGCTCATATGCG
CCGCGAGTTACGCAGCTTACAGGTGCATTGCTATTATATGTACAACGTGGCATGGGCCCAGAAACCTCTTACATAGGGTG
TCACCGCGTAAAATGCCTCATCGAAGTATTATTTTCGTTGTAGTATTGACTGATCTTATTTGACTGTTTACTGCTACTAG
CCCTTTATTATGTGATCAATATTTGCAGGGCTCTACAGAGTGCACTGTAGATACAATAGGGCGCCGTGACGAATTGCTTT
TGCATGTCTTTCTCCAACTTACAAACTGAAAGTTTTAGTACCGTGCTTTTCCTTCAGCTGGGACTGCTTTGGCACCCTCA
TCTTCAACAGGACAGCCAAACCGTATCAATGACTGACAGCTTCAACTTTGGGCCGCTTTTGAAGAATATCCGCGGTGGGG
TCCTTCTGTCGGCAAAGCTGGTACGTTGCTCTTAAGCGGGCCTTTCGACGCCTCACAGCAACCATTTTATCTCCTGCCCA
TGATCCAGCAGTGGTTATCCTTGGTTCTCAACCTAATTGTAATGACACTGGCGGTGCTCCTGGTGGCGCTTACACTCAAG
TTGAGATCGACTTTCGGGTCCACCGTTGTCGCATTGGTCAACCTAATGTCTTTCGGCCAGACTCTGAGGGGGGTTGTCAT
GGCATGGACACTGATAGAGACATCGATTAGCGCCGTGGCTAGAGTTAAAGAGTTTAAGAAGCAGACACCCAGAGAGTCCG
AGGAAAAATAACCTGATCCAAGGGACGGCTTTATCGGTCAATGTAAGCCCTCTGGAAAAATAGGTTGCAATGCTTTGACG
GCGTCTTGCGGGTCAGAAATTCCATAAATTCGGGAACTTGTCTCAGTGAAGCTGGATTAGTAACATTCTAATTCTAAGCC
TCATGCAGACTCCATGACACTTGGAAATGTCAGCCTGGAGATTCAAGCTGGCGAGAAATTCGGAATCTGCGGTCGTAGCG
GAAGGTAAGTTCGCATATCTCTTTAGGGCTCGCATTAGATTCACTGACTTGGTGCTTGGCGTGATAGTGGCAAGTCGTCC
TTCCTCGCCACCATCTTTCGCATGCTCGACATCCGAGGCGGCAGCATTGAGATTGACTCGGTCAACATACAGACGATCCC
GCTGTCAACAGTTCGCTCAAGCATCAGCGCGATCTCGCAGGACCCCTTTTTTTTACCTGGAACGATCCAATTCAATGCAG
ATTCATACGGGGCTGCTTCTGAAGTCTCGGTGATCGAAGCCTTGAAGAAGGTTCAGCTCTGGGATACAATACAACACAAC
GGGGGCTTAGACGGCGAAATGAAGCCGGTACTCTTAGTCAGGGACAAAAGCAGCTCTTTTCGCTCGCGAGAGCCATCTTG
CGTAGGTGAAAGATCGTGATATTAGATGAAGCTACAAGCAGGTAAGTCTTTACAGTGTTGGAAAGCATGTCTTTCACCCT
TTTTGAGCTGAAAGGGTGTATGAGAGTGTTATACTGACAACATACGGGACAGCGTGGATCTCGAAACCGAGAAGCTGATG
CAGGACATCCTAAAGGAGGCCTTCCGAGATTGCACAGTCATCGCCATCGCGCACAGGCTCGATACTCTGATAGAATTCGA
CCGAATAGCTGTCTTTGACAACGGCAAGGTCGAGGAATGTGGGGCACCAAGAGACTTACTGGAGAAACAAGACTCGGCTT
TCAAGAAGTTCTGGGCAGCGGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62