GenePrediction:GLEAN_3752 Details

Name: GLEAN_3752
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:696296..698781 (+ strand)
Length: 2486
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:696296..696319 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_113:696436..696501 (+ strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_113:696558..696691 (+ strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_113:696872..697018 (+ strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_113:697102..697254 (+ strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_113:697318..697679 (+ strand)
Length: 362
Type: CDS
Source: GLEAN
Position: GCSC_113:697735..697751 (+ strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_113:697815..697910 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_113:697978..698106 (+ strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_113:698178..698255 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_113:698315..698342 (+ strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_113:698408..698781 (+ strand)
Length: 374
>GLEAN_3752 class=GenePrediction position=GCSC_113:696296..698781 (+ strand)
ATGTGTGGTGTTTCGGCCATTATGGTGTGTGTTTCTCTCTGCATCATCTCCTTCGTATACGTATCCGGAGAGATGCGTGT
GTCAAGTGATGACAATGCCAAGACAAGCTAGAAAACCAATCAAGCTAACCGTATGGACAGTTGGGCGATCCCAAAGCCGA
CACAGCCGCCGTCGAGCTTCACGAGAGTCTCTTCTACCTCCAGCATGTGAGTTGGCTACTGGGCGCTCACAGTGTGCGTT
GTGACTCTGACGAACGAAACAGCGTGGCCAAGATGCCGCCGGTATCGCAGTTTGCCAGAGCGGAAGGGTGTATCAATGCA
AGGGCATTGGCATGGCCAGCAAAGTGTTCGATGAGGGCAAACGCGTGACGACAATGACGCTTCCTGGCTTTATGGGGTAA
ACTCGCCGTTACCAACAACATCCTGGCTATCTTCAGCATGGAATGGACGCTGATGTTTCCAGAATCGCTCATGTGCGGTA
CCCTACTGCAGGCACCACCTCTGCGTACGCTCGACTGGAATTCGCAACCCCATCCAAGACTCCACTTTGAGCATTCATTC
GTTAACATCATCGCAGAGCCGAAGCACAGCCATTCTTCGTTAACTCGCCTTACGGCTTGTCGATGGGCGTGAACGGAAAT
TTGACAAACACAAAGGATCTGGTCCGATTCTTGGACGTCGAGGCTCGACGCCACGTAAACACTGACTCGGACTCGGAACT
CTTGTGAGGACGATCAGCTTTGTGTGTTGCGGTACAGTATCTTGGCTTTCATGCCGTTCGCTAACTCGGGACTTCCGTTT
CTCTAGGCTCAATATTTTTGCTTATGCTCTTGGCGAACTTGGCAAGGTCCGAGCTAATGTAGACGATGTCTTTACCGCCC
TGCGCGAAGTCTATGCAAGATGCTATGGTGCCTTTGCTTGTACGGCCATGCTTGCCGGTTTTGGAATCTTGGGCTTTCGG
TACTTGACCCCTCCTCCAAGTGTGTCACGAACTGCCTGACTGATATCTTGTCAATCTGGCAGCGATCAGAATGGCATCCG
TCCCCTTTGTCTCGGCTCTCGACCATCCGAGACTCTGGAAGGCGTCAAGGACTATTTCTTCGCCTCAGAATCGATTGCTC
TAACACAGCTTGGATTTACCGATATCGTGGATATCTTGCCCGGTCAGGCCGTCTTTATAAAGAAAGGAGAGGCTCCCCGT
TTCTCACAAGTCGTGGAGGCGAAATCCTATACTCCCGATCTATTTGAGTTTTTGTATCTGGCGAGGCCTGACGTGGAGAT
GGACGGGATCTCTGTCCATCGCAGCCGACAGAATATGGGACTGAAGTTGGCGAACAGGATGCGACAGGTTCTGGGAGAAG
ATGGGATCCGGGACATCGATGTCGGTAAGTGGTTCTGATCTCCTGCCAACAACAGCCGCTGCTAACATACTTGTCTTAGT
TATTCCTATACCAGAGGTAGGCTATTATAATGTGCCGCACCGTTAGCGGCGCCTTTACTGACGGAATTCTTACGCTTAGA
CGAGCAACACAGCCGCTGCTACGCTGGCGCTAGAGCTGTCAAAACCTCTTTCGAATGCGTTTGTAAAGAACAGATATATT
TACCGCACATTCATTGTACGTCTCTCGCCGCACATATTTTTACAACGCGAGCAAATTTTGACATGTTTATCTCTTTCCAC
AGGTTCCTGGGCAAAAGGCACGACAGAAAAGCGTGCGGCGGAAACTCTCACCCATTGCATCCGAGTTCAAAGACAAGGTT
GTTTGTCTTGTGGACGATAGCATTGTACGGGGAACGACTTCCCGTGAAATCGTACGTAATAGGGGATGGAACTGCACTCG
TCATACATTTGACTAACTTTGGATTAATTTCCTTTTAACCAGGTTCAAATGGTGAAGGAATGCAAGGCGAAGCGGATCAT
TCTTGTATCTTGCAGCCCGGAAATCACCCATCCCCATGTTGTAAGCATGACAGCATAAGCATACAAATTCAGGGAGTTAT
TGCTGACTAAGCCTTCCAGTACGGCATCGACCTTGCCGATCCAACTCGTGAGCATATAATTCACTTAGGAACTGTGCTGT
TAATCGACGTACTAACACTGTGCTTCCTCCAGAACTCCTCGCTCACGGCAGGACACTGAAGGAAATGACCGACCTGATCC
AGTGTGATGACCTAGTTTTCCAGACGCTAGAGGACCTCAAGGCAGCTTGCACCGAAGCGGCCGACGGAAACAGCCAAGTG
ACGGATTTTGAGGTTGGGGTTTTCTGCGGCCAGTACAGGACCCCTGTGCCCGATGATTATTTCGACCATCTGGTCAAGCT
GCACGGAAGCGAAAGCAAGAAGCGGAAGAGCATTGCCATCTCTGGTGAAGAGGCAGGCCCTACCTTGTTTGCAAGCAGTG
GCCCGGTGAATGGAACGCTGCCACCACCAGAGGCATCGTTTCCCGATCGGCCTAAGGGTGTGGAACATCAAGAGGACATA
AGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62