GenePrediction:GLEAN_3755 Details

Name: GLEAN_3755
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:706823..711047 (+ strand)
Length: 4225
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:706823..706887 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_113:706943..709151 (+ strand)
Length: 2209
Type: CDS
Source: GLEAN
Position: GCSC_113:709256..710074 (+ strand)
Length: 819
Type: CDS
Source: GLEAN
Position: GCSC_113:710139..711047 (+ strand)
Length: 909
>GLEAN_3755 class=GenePrediction position=GCSC_113:706823..711047 (+ strand)
ATGCCGTCCGCAACAGACGAGGGTGTTCGAATTGCCATTGATCGGGGAGGGACATTTTGCGACTTGTATGGTTTATATCG
TTCTCCTCTAACTTTTACCTGGAACTAATGATGTTGCCAGCTGGGCTCGAATTCCTGGCAGGAAGGATGATCTCGTCTTC
AAGCTGCTATCAGTTTGCCCCGACGAGTACGATGACGCACCGACTGAAGGCATCCGGCGCATCTTGGAGACTGCCACCGG
CGCCGAGATCCCCAAGGGCACTCCGCTGGACCTGACGCACGTTGAAAGTATTCGCATGGGCACCACTGTTGCCACCAATG
CCCTCCTCGAACGAAAGGGCGAACGAGTGGCCCTGCTGATCACCAAGGGCTTCGGTGACCTTCTGCTCATTGGCAACCAA
GCCCGGCCAAAGCTTTTCGACTTGGCCGTCCGCAAACTCGACAAGCTGTTCGAGTGTGTCGTCGAGGTGGACGAGCGCAT
CACTGTCGAGGGTGCATCCGAAGACCCGTCTCCGATTGTGGGTAATGTGGCAAATGACCCAGAGCTGTTTTATGGAACAA
ACGGAGAAGTCCTGCGCCGTTTGAAGAAACCCGACCCAGAAGCCATCCGGGGCGATCTCAAGAAGCTGTGGGAAGATGGC
TACCGCAGTGTTGCGGTTGCGCTAATGCACTCGTACAACCACCCAGACCACGAGATTCTCGTTGGCGATATTGCCCGGGC
GCTTGGCTTCAAGGTATCACTGTCTTCGCAGCTGCAGAGCATGATCAACCTGGTACCGCGTGCACAGTCCGCCACTGCCG
ATGCGTATCTCTCGCCGATAACGCAAAACTACCTTGACAGTTTCCGCAAGGGCTTCAAAGGCGGGCTGGAGGATGCGAAC
GGCCACAAGCTGCTGCTATCCCAGTCTCACGGCGGACTGGTGCAGTACAAGGAATTCACCGGTCTGCGGGCCATCCTCTC
TGGTCCAGCTGGTGGCGTTATCGGATATGCCAAGACATGCTTCGATGCAAACGATGGCACGCCTGTCCTCGGCTTCGACA
TGGGTGGCACCAGCACCGACGTCTCTCGCTATGGCGGTGCACTGGAGCATGTCTTCGAAACGACCATTGCCGAGATCCCT
ATTCAGTGCCCGCAGCTGGATGTCAACACTGTTGCTGCCGGTGGTGGCTCCATCTTGGTCTGGAGCAACGGCCTGTTCAA
GGTCGGGCCAGACTCAGCCGGTGCCTTTCCCGGGCCTGCCTGCTACGGAAACAATGGCCCACTGACGATAACAGATGCCA
ATTGCTTCCTAGGCCGCATTCTGCCAATGTACTTTCCGCGCAAGCTGGACGTCGAGACGGTCAAGGAGAAGTTCTTGGCC
CTGACCGAGCTGGTCAATCAGGAGAAGCATGGCGACGACAAACTCACGCCTGAGCAGATAGCCATGGGCTTCATCCAGGT
AGCCAACGCCACAATGTCGCGTCCGATCCGCAGCCTGAGCGAGGGTCGCGGCTTCGAGGCATCAGTCCACAACCTCGCCT
GCTTCGGTGGTGCCGGTGGCCAACATGCCGTGGCCATTGCCCGCGATCTCGGCATAAAGCGTGTGCTCATCCACCGCCTG
TCGAGCATCTTGTCGGCCTTTGGAATGGCGCTGGCCGATATCGTTGTCGAAAAGCAGGAACCGGAGGCGGTCGTTTGCAA
TGCTGACGGCACCGCCGAACGTCTCGAGAAGCGCTTCTTGTCGCTCGAGGTGCAGGCGACGGAACAGCTGGCCGCACAGG
GAATCCCTTCCCATCGGGTCGTGCATGAGCGTTTCCTCAACATGCGCTATCGCGGCAGCGACACAGCCCTGATGATTGCC
CGGCCGGAGCCTGTGGACGACTCGGCCAAGTCGGATTATGCGGCCGGTTTTGTGGCGCGCCACCAGCGCGAGTTCGGCTT
CACTCAGCAGCGAGATATTCTCGTAGACGATGTTCGTGTTCGCAGCGTTGGCAAGGCCATGGAGCTCCCTGTATCCAACC
CATTTGAGGCTCTCCGCGATGTTCAGGCGATGCCGTATATCAATGTGTCGGCTGCCAAGTGTCAGCGCATGTACTTTGAA
GACGGCTGGGTTGATGCACCGATCTTGCATCTCACCAACCTCGAAAAGGGTCACAAGGTCAAGGGTCCCGCTGTCATCTT
TGATGCCACGCAGACCATCATCCTCGATGCGGCGAGCGAGGCTATCGTGCTCGATGAGCATTTAGTCATCGACCTCGCCC
TAAAGGTGGAGGACTCGGCATTGACCAACGATGTCGACCCAATCAAGCTGTCGGTCTTTGGCCATCGTTTGATGTCGGTT
GCAGAACAGGTAAGAAAAAAGGAGCCGAAAAGAGGAAGATACGAACGCTGGTTAATCAGGGACAAAGAGGGAAGGGACGA
GCTCGCCAGCACGTGATACTGACTCTTTCCTAGATGGGCCGAACTCTGCAGAAGACGTCGATTTCGACAAACATCAAAGA
ACGCCTCGACTATTCTTGTGCCGTATTTTCTGCCAACGGCGGCCTGGTTGCGAATGCGCCTCACATCCCGGGCCACCTGG
GTTCCATGAGCACCGGCATCCGGTACCAGGCCGACCATTATGGCAAAGACGGACTGCGTCCAGGTGATGTGATCCTGTCC
AACCATCCCTGCGCTGGGGGCACTCATCTTCCCGACTTGACGGTCATCACTCCGGTCTTTGACTCGAACGAGAATCCGAC
AGAGATCATGTTCTTTGTGGCCAACCGCGGCCACCACGCAGACATTGGTGGCATCTTGGCCGGCTCCATGCCGCCCAACT
CGACAGAGCTGTGGCAGGAGGGCGCAGCAATCGAGTCCTTCAAGATGGTCAAAAACGGCGTCTTCGATGAGGCCGGCCTG
ATCGAGGAGCTGTCGGTGAAGCCAGCCCAGCACCCAGGCTGCAGCGGTACCCGGACCCTGCGCGACAACATTGCGGATCT
CAAGGCGTCGGTGGCGGCCAACAACCGCGGCATTTTCCTGATCCAAGAACTGGCAAAACAGTACACCTGGCCGGTCGTGC
AATTCTACATGGAGGCCATCCAGCGCAATGCCGAAGAGGCCGTCCGGGGCATGCTCAAGCAGCTGAGCGTCCGCTTTCGC
GGCCACAAGCTCAAGGCCGTTGACTGGATGGACGATGGGACGCCGTTGGCCTTAACCGTCACCATCGATGCCAAAAAGGG
CTCGGCCAAGTTCGACTTCACTGGGACCGGGCCAGAGGCCTTTAACAATCTGGTAAGTCTTTCCAGTCCCATTCCTGGCT
TCCTTAAGCCACGGCAACCCTCACACATATTCTTAGAATACACCTTCTGCCGTCATGTATTCGGGCATCATCTACTGCCT
GCGGTGCATGATCTCATCCGACATCCCGCTCAACCAGGGCTGCCTGGCCCCCATCGAGGTAGTCTGCCCGCCGAATACGC
TTCTGTCGCCCAGTCTCGAGGCCGCCACGGTTGGCTCCAACGTGGAGACCTCGCAGCGCATTGTCGACCTGATTCTGAAA
GCTTTCCGCGTCTGCGGCGCCAGCCAGGGCACGTGCAATAACCTGACCTTTGGCTACGGCGGTACCGACGAGGAAACGGG
CGAGATCGTCCAAGGCTTCGGCTACTATGAAACCATTGCCGGTGGTGCTGGGGCGGGTCCCTCGTGGGATGGCCAGTCGG
GTGTGCACACCAACATCACCAACACGCGCATCACAGACCCCGAGGTCTTCGAAAAGCGCTATCCCGTGCTTCTGCACCGC
TTCGGCATCCGTCCTGGCAGCGGTGGTCGCGGCCGGCATCATGGTGGTGACGGATGCGTTCGCGAGATAGAGGTGCGACG
TCCGCTGCAGGTCAGCATCCTCTCAGAGCGCCGCGTCATCCCACCGTATGGCATGGCTGGTGGCGGGGAGGGCGGTCGTG
GGCTCAACTTGTGGGTTCGACACGACCCCCGCGATAAGACAGCGCCACCGCGCACGATCAGCCTCGGAGGCAAGGCGACC
GTGCCGATGAATCCGGGCGATCGTATCATCATCCACACCCCTGGTGGTGGTGGCTACGGCAAGAGTCTGGAACCCTCAGA
CGAGTACCACCCGGATGAAGAAGAGGAGGAACTGGCGACCACTCAAGCTGGCAAAGGGAACGGAAGTTCCGGTAATGAAT
TTAATCATGTGCCACGGGCAAGCGGCAGCGTTGGCATACGGGAGAGTATGGCGGCCTCGAATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62