GenePrediction:GLEAN_3756 Details

Name: GLEAN_3756
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:711598..712181 (+ strand)
Length: 584
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:711598..711947 (+ strand)
Length: 350
Type: CDS
Source: GLEAN
Position: GCSC_113:712010..712181 (+ strand)
Length: 172
>GLEAN_3756 class=GenePrediction position=GCSC_113:711598..712181 (+ strand)
ATGGCTGACGTGTCGGGTATCACTGCGCCAGCAGAACCAGCTTCCGCTAGCCCCTCTAAAGGACTGGCGAAAGACCAGGT
CTCGCCGCCCAAAGAGTACGCCAGCGCCATAGAGACGGGCATTGCAGATAACGGCGACAACGACAGCAAACCGGGCGCGG
CAGGTAGCGAGAGCGATAACGAGGGCTTCGGGTCGGATAGGGTGTCGACTGCTGGCACCAATCTCTCGAGTAGTGTGCGT
GACTACGCCTTTGAGAACAGCCGGCGCTACCACAATTTTCAGGAGGGCCGCTACAACTTCCCTAACGATGAGCCCGAGCA
GGAGCGCGAGGATATGAAGCATGCCATGAGGTCCCCTTGGGCACGTGGCCGCACAACCAGCGGCTCAAGGCCATTGGACT
CTACAACTGCAGCATGATCTACGACGGCCTGCAGGGCATCTCGCTGAGGCCCTTTACGCGTGAGCTCAAATGGACTACCC
AGGAGGTGGAGGCTTTTCTCGTCAATGTCATGCAGGCCCTAATGGATGACAACCAGCAAACCCATCTGCTGTTCCACGTA
GAGATAGGACAGAGGCCATTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62