GenePrediction:GLEAN_3759 Details

Name: GLEAN_3759
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:727323..728753 (+ strand)
Length: 1431
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:727323..727439 (+ strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_113:727503..728753 (+ strand)
Length: 1251
>GLEAN_3759 class=GenePrediction position=GCSC_113:727323..728753 (+ strand)
ATGTCTGACGACGTCTGTGGTCCCTCTGGGGCCCTCAAAAGTTTCGGGAGACATGTCAACCAGGACCAGTCCCGCCATCA
AGACCGAGCGCGGCCCGCTCCTGGGGCTTCTCAAGCCGTGAGTTGCAAGGCTTTACCAGATTTGCGGGTTTGGCCATGCT
TGCTGACATACACTTCTTAGAACTTCCGGTCTACGCCGGCTGGTCCCAGCAATGAGGCTGAGTTTCGAGCCTTTGCCTCT
GGCTCCAACCTCATCCTTCAGCCTGGCTCTGAACTCATTGACCCGCGGCTCACTTCCCAGGATATGGCCACATTTCGTCC
TGGGATGCACCATCCGCAGATGGGTTTCGCCAGTCCTGGCCCTGTTACACCTGTCGGTATGCCGACTGCAGGCCCTGTTA
CTATGCCCATTGCCGGTCCTGTTGCCGGTCAGATGCAAGGTTTTCATCGTCCCCCTGTTGCCCAGGCTGCTGGCAACTGG
GCCCAGGAATTTTCTGCAATGAACAACCAGAGCCAGGTCTACCCCTCGTCAGCAAGCCATTTGGCGGAGCCTTACGTGGT
CCAACATGCTCCTCAGCCGCACATGCAGCATGCTGCCTTTGGCCCGGGTCAAGCTTTCAGGCCCATGATGCAAGCTTACC
CGGGTGTTGTGAACTATCAGCAGCCTGCTTTTCAGCAGCCAACCTTTCAGCAGCCGGCTTTTCAGCCGATGCCTGCTTTC
GCTGCTGCCAGCAATCAAAATGCAGCTTTCCAAGCCCGCGTCGTCATGGCGGCCCCAGTCACGGGCAGCAATCTCATTGG
GGGCCTCACCGAGGCAGAGCTGGATGCCCGATTCGCTCAGCTTGAGTCGGACTTTGAGTTCGCAAATGAAATGGATGCTT
GGATGGCCGAGTATGGCCCAACCCCGGCAGAGCGCGGACAAACAGCGACCACTGCTCACCAGGAAGAAAATGTGGACGAG
ATTCTTGAGCAGCTTGCTGAGGAGCTTGAGGCCCAGAAACTCGCCGAGGCCGCTACTGTCGGTGCCGCGATTGCTACTCA
GACTTCCCAGAATACCTTGCCAGAGTTCATGGGCGAAGAGCACACGCGGGCTCACAACAACGAACTCCGTCAGGAGCAGT
TGACTCAGGCTCTGGAGCAAGAGGAGGAGTCCTCGCCGACGCAAGAGCAGATCGAACAGGATGATCTTGCCCGAACGGCT
GAGCAGATTGTCAACACTCTGGATGCCCACCCGAACGAGCGCTACCGTGAGTCGGCCTTTGTTGGCCTGATGCGCCGGAT
TCAGGCCCGCGAGGTCACCGTCCAGGGCGACGTGCTCGTTGACTCGACGACTGGCTTGCCAGTGGAGTCAGCCGTTTTGG
CTGCCGAGCATTCTGACACTGGGGCTGGAATTCCCATTCCGCCTGCTGGATCGCAGCAGGAGGTGGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62