GenePrediction:GLEAN_375 Details

Name: GLEAN_375
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1375573..1376532 (+ strand)
Length: 960
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1375573..1375984 (+ strand)
Length: 412
Type: CDS
Source: GLEAN
Position: GCSC_167:1376078..1376532 (+ strand)
Length: 455
>GLEAN_375 class=GenePrediction position=GCSC_167:1375573..1376532 (+ strand)
ATGTCCTCAAGCCAACAATTTCAAAAAGATATAGAGGCATCCAGCCATCGACGGATTCGACAGCGCCGGGACCGCGACTC
AGACGAGCTTGAAGAGGCGACTGGGCAAACAACTTCACGAGCCTCTACCGACCAAGACTCCGGCTCTGACACCGAAACAG
AGTCGCCTACAAAGAAAAGCAAGAAATCCCGAGGCAGGGGCAAGGGCAAAGACAAGGGGAAAGGTGGAGAGGAGCAGCAA
CAGCAACCACACAACAACACGATGTTGCCGATACCATCACGATCCGGGCGAGCGTCCTCGAGTGTACGCCGGCAACCGTC
CAAGGGCAAGACAAAGACGGACGACTGGAGTGAGGTGACAGACCCAGAGGAGCGAAGGCGTATTCAGAATCGCATTGCCC
AGCGGAAATTTCGTAAATCCGTCCTACCCCAAGATCGTCTCGGCCTCGCTCCGAGACGCACAATTTTGCCCCGAGATGGA
TGCTGACAAATCCCTACCCCCACAGGCGAGAAGGCACGCGAGCAAAAGGAGCGTACAGAGCGGGACCAGCGCAACCAGGA
ACATGCCGCCAGCAGCTACCAAGTACCCGGGCCATACGACTTGGCAGGCGACGGTGAGCTGTCGGGATTACCTTGGGGCG
GCCCGAGCTTGCGCTTTGTAGTGGCCAAGGGCCACGAGTCACTCAGCAATCAGGGTAGCCGGAGGGCATCTGAATACCTG
ACCGACGAGATGGCAATGTATGCCTCCGCCAGTCGTAGCCGCAGAGCGACAGAGGCGGCTGAAGGGGGTGCCGCAGAGGC
AGACGCCGCTAGCTACAGATATAGCGACGACAGCCAGCTGTACTTTGCAAGCGGCGACGGCAGTCAAGCTGGCAGCAGTC
GAAGCAGCAGCGATTTCACATACACCAACTTAGCCGAAGACCCGCAGTACTTTGACGAGTCTCCCTACTACTACGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62