GenePrediction:GLEAN_3761 Details

Name: GLEAN_3761
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:734749..739380 (+ strand)
Length: 4632
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:734749..735097 (+ strand)
Length: 349
Type: CDS
Source: GLEAN
Position: GCSC_113:735160..735787 (+ strand)
Length: 628
Type: CDS
Source: GLEAN
Position: GCSC_113:735859..736248 (+ strand)
Length: 390
Type: CDS
Source: GLEAN
Position: GCSC_113:736870..736895 (+ strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_113:738863..739380 (+ strand)
Length: 518
>GLEAN_3761 class=GenePrediction position=GCSC_113:734749..739380 (+ strand)
ATGGCTGTCGGCGCGAGACCACAGCGCGCTCCCGACGACGGTCGCACGGCAAAACAGGTCTCCGGGACCGTCCAACGCCC
GTATCGCTCCCTGATTGCGGCTTTTTGTTCCTGGAAGGCCGTCCTCCTGCTCATTGCTGCCGTCACCAGTTATGGCAGTT
TGGCCTACGACACGTCGGCCAGCCTGGCCAGTGCCAACCATCAAGGTGCAAACGGCCACGATCTCGCCACCCGGCTGTCC
AGCTGGGATGCCGTCTACTTTGTCCAGACTGCCCGCCGCGGCTACTCCTTTGAGCAGGAGTGGGCTTTTGGCAGCGGTTT
GCCCCTGCTCGTCTCCTTGTTGCACAAAGGTCAGCTGTTCCACTATTCAGCTCTCCTCGGAATCTCCGAACTCTTTACTA
ACGAATGCCAGGCTTTGCCTCACTTGGCGTCACCTCCAATATATCCGTGCCCATCCTGGCCATTGCTGTCTCCCATGTCG
CCCACCTGCTGTCCGTCTTGGTGCTGTACAAGCTGGGCAGACTAATCTGGCTTGGTGATGCCGGCCGGAGAGCTGCTTTT
ATCGCCGCCTGCCTGCACATCTTGTCGCCCGCCGGCCTCTTTCTGTCTGCACCGTACGCCGAGAGCTCCTTTTCTTTCCT
CTCGTTTGCCGGCCATCTCATCTATGCCACCGGGTGTCTGCGCGACCAGACAGACGCTCTGCCCTCGTTTGGTGGCGATG
TCTTCCGCTTGCTTGCAGGGTTGACGTATGGACTGGCTAGCATCTTCCGCACTAACGGCCTGCTGAACGGCGTGCCGTTT
GCCTACGAGGCCGTGATGGGGACCGTCGGCATGACACGCCGGCCCAGCTGGCAGCTGTTTCGACGGCTGTGCTTTCTCGG
AGCTGGCGGTTTGGCAGTGGCAGCGGGCTCTATCATCCCTCAGACGGTGGCATACCTCCAGTATTGCTCCGAGCCTTCCG
GAATCCCAGGCGAGCATCTACGCCCGTGGTGCTTACGCACGGTCCCCAGCATTTACGGGTTCGTGCAGGGGCATTATTGG
TAAGTTTGCGCCCCCCCAGCTCCTTCATTTGTCGGCCATATATGTTTGCTCACGCAGATGCAACATACAGGAATACCGGG
CTGTTCAAATACTGGACCGTCTCGAACATTCCACTGTTCCTTCTTGCCGCTCCTATGCTGTCCATATTGACCTTGTCAGC
CAAGGACATCTGGTCCGACACAGACGGCCCACGGTCCGCACCGGTTGAAATGAAACGTCCTGACTTTGACGGGCTTCCTG
ACGGCGGTGACGTCCAGCCCAAGCTCATCCAGATGGTCCGTTGCCTCGCAGTGGCCCAGTTGTTTCTGGCGGGACTTGCT
TTTACTAGCTACCACGTCCAACCCATCACGCGTCTGTGCTCTGGATATCCAGTGTGGTATTGGTGGTTGGCGCGAAACCT
CGTTGGGGGCACGCAGGCGCAAGAGGGCTTAGCCGTCAAAATTGTGTGCTTCATGATCATGTATGCATCTATTCAGGGCG
TATTATTTGCGTCTTTCTTACCACCGGCTTAGAGATGCACTGGCACCCAAATCAGAAGACACTGCATAACACATTCATTG
TCTCTGGTTGCTCCTGACAATCAGCACTCTCAAAAAGCTCAACATAACTGTCCAGATCTCTTACTATCAGGAGACGTATT
CTGGACTAACCGCTGACTAAGGAACCTTTTGGATTTGCTCCGTCATAAAGCTCCTAATGGAAGTAGCGCATTGGTTGTGC
CTTCCTCCCGTAAAGGACCCACTGCAAAAGCACAGCAAGTATTGGGGGCCATTTTCATTTCGGCCGGGTCCAATCAAAAG
GAGCTTTGCTTGCTCCATAACGCAACTTTTTTCATGCTTCTCTCGTCTTCCACGACCTCTTATCAACAGCGGTCGACAGG
ATTCGTCCTCCGCTGAGTTACTTGATTTGTTTCAGAGAAAAGCCGCCTCCTTTGAGCTGCCTACGTCTGACAGCCGTCAT
CTGGAAACAAGAAATGTGGACGGATCTGCCATCTACACCCATTTTGAAGATTGGAAACATGACGTCTGGTTAGCACTATG
CAATGCAAAAAGCTAACAGTCAAGCCGCTTACACTCAGCAGGACAAAAAACACAGGCCAGCCAGACCGTGAGTGAAGCGG
CGCATGGCTTTAACAGCGGACCAAAGCTCAAGTTAGAATCTCGGGCGGCAGATCTTAAAAAAGTGCTTTTAGGTCAACGC
CAACTCGCCGCTGGGGTTAATGGCAGGCAGCTGTCATCATCACCATCTGACCCAGATCCACTGACAATAAAGGGCAGTGT
TGTTGATAAGGCTCAAGCACCTGAAAGTTCTGCTTCAGGTACCGCCTCACCGTCCCTGTCGGTACGGCAAGACTTCAACA
ACGACGACATTGATGACCTCATTGCAGGCTTGCTACCGCGAGAGAAGAGCCCAGAGAGAGTTGGCGAAGCCGCTTCTGCA
AGCACTTCAAAAGTAGCGCCGGAGTTAGTCGAGAAAACAAAAATGCATGCGACGAACGACAGTAAGGGTAGCGTGAGCAC
TTTTATGAAAACAGTGCATGTATCTCCCACGTCGCTCAAGGTGCCGACAACAGGAGCTCAGATGACGGAGAGCCCGCCTT
CAGATAGCTCTCCATCGAAATTACTTGTTTCCAAGGAGCCTGTCCTAAACACTGCCACTGAGATGGCGTCTTTGTCTAGC
ACGTCTTTGGGTACTGTCAATGACCATGAAACTACAGCCAAGGCAGAGCAGCTCACGGGGGCCATGGACTCAGGCCGATT
GAGAAGCATAATCATGTCTGGCTCTGATGCCAACAGCCAACAGTATGAAACACTTTCGTTTTCAACGGCCAACACTCACG
CAAATATTCGCGCGCCTCTCCGTGCAGATGAGCCGTCTTGTAGGGCCGTCTGTATCAATGCTGATCAAGAAGCCAAAGAT
CTACAAGATTGGCTACTTTTAACGAATTACTATGATCTGCCTCACCGAACCCAGTTTTTGGCTCGGCGCCGAAGGCTGGC
CGCTTTAGAAATAGAACGACAGAAACTTTTAGAAGAAGAAAAGGAAGAGGCCAGTTTATCTGTCCTGCGACAGTTTACGC
CTGCCAGTCTGAAGGCTATGACTTCTCTTCCTGCATCTGCTGCCTCTCTACTGAGTTACCCGGGAGCTGTCGTCTCTCGT
GATTCCCCAGTCTTGTTGTCATCGAGCTTACCAACAATCTCTTCCTCATGCGTTCCGTCTTTACTGCCCACGTCTCCCTC
TCCGGCTTATCATGCGGAGATTAGCACTGCACTGGGCGGCGACAAGGCCATTGCAGGCACAGACGCAGTGAATACAAACG
GAGCTACCATCATTACACAATATATCAGCTCTGCAAAACGCGGACGCGAAGTGAATTTGGCCGAGGAGAAAAATTCTACC
AAGCATCCACGGAGAGCTGCCCGAACGGAGAGCACAAGTGGGAGAGCCGTGGGTGCGGTGATCAATCCCAACAAGCAAAA
GAAAGCCAACGGCGCCATCAACGCCGATCGCCAAACGGCGAACAAAAAAGCAGATGCTTCAAACCCCGGTGCTATTCAGG
ATACTTTTAAGACTCCCCAGCGAAAGAATGTTCCCCTGAAGGGTACTGGCGATGGAGTAGGATCGTCTTCTATGGAACGT
GCCAACAACCTTCGCCGGCAAAGCTTTGACCGGCCTGGTTTGGCGGACAACCGCAGAACCAGCACAAGCCTCGAAGAATT
TCCTGGGACCGTCCGAACAGCTGACTTCGCACGCTACTCTCCGCCGCCTCGAGATTTGGACAGCCGCGGTAGAAGCCCGC
AGCGGTCCAATAATGCCGACAGGTTTGACAGATTCGACAAACGTAACACGATCGACAGGTATACGAGTGAAGAAAACGGT
CGTCGCCAGTGGGATGACAACCAGAGACAATATCAACGGCCGAGATTCATCAATAGTGGTCAAAAAGGTGGCAAGTAGAC
CCGTTTTTGTTCCCACCCCTACTTTTAGAAAACTGTCGCAGAGCCGTTGGGAAAAGAGGGAGTTGGACTAATCATCGTGA
CCATAATTTCATGTGCTAACACGCGCCACCTCAGACACTCGATTCTTCATGTTGAAATCCTTCAACGAAGGCAATGTTCG
CCGGGCAATGGCCGATGGTGTCTGGACTACGCAGCTTAAGAACGAAGAACTTTTGGTAACCGCCTTCAAGAAGTGCCGAA
ATGTCGTCTTCTTCTTTTCTGTCAATAAGTCACGGGCATTCCAGGGCTATGCGCGCATGGAATCGCTACCGTCTGCCAGT
ATAGTCAAGCCAAGCTGGATGGACAACATCCACTGGCAGACGACGGAACCATTTCGTATCGCTTGGTACAACACGACCAC
TACAGACTATCGCCATGTTGCTCATCTTGAAAACGATCTAAACGAGCACCGTTCAGTTATTATCGGCAAGGACGGCCAGG
AGATCGACGATGAGTGCGGACGTCGCCTCATGGAGGAATTGGACGTCACGGCAGACGGCGAGGCAGCTGGCAGTGCAGCT
GGCCGTGACCGGCCAGATCGCTTTCGGACGAGTCCGAGTCTAGCCAGTCGAGTGACGAGTGGCCGGCCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62