GenePrediction:GLEAN_3765 Details

Name: GLEAN_3765
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:785704..786585 (+ strand)
Length: 882
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:785704..785974 (+ strand)
Length: 271
Type: CDS
Source: GLEAN
Position: GCSC_113:786039..786152 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_113:786218..786585 (+ strand)
Length: 368
>GLEAN_3765 class=GenePrediction position=GCSC_113:785704..786585 (+ strand)
ATGTTTGCGCGCAGCCAAGGGCGGGCTCTTGCCCGCACAGCCTCCGCGGCGATTGCGACGCCGGGACGCAGCCAATGGGC
GACGGCGGCCGTTCCGTGCAGCTGCTCGCGGGCGTTTTCGGCGACGACGACACAACAGTCCAAGCTGGGCCGGACACCGA
TCTCGATCCCGCCGGGCGTCGAGCTGCTGATCGGCGAGCCCAAGGTCAAGAAGGACCCGACGACATATCTCAAGATCCCG
CGGCGGACGGTGACGGTGGAGGGGCCGCTAGGTAGGCAATTGGCGCCGTTCCTAGAAGGATTTCTTGTTCTGACTGTTTT
TTCCCGCTCTTTCAGGCACCCTCGAGCTGGTCCTGCCGTCGTTTGTCCACATCGACCATGACGCGGAGCAGCGGCGGGTG
ACGCTGAGCATCGAGAACCGCGATCTGAAGGAACAGAAGCAGATGTGGGGTGAGTTGGGGGGGCTCGACACAGGGACGAT
GCGCCGTGGCGGCCGCTGCTAACAAACGGAACAGGCACGACGTGGGCACACCTCAACCGGTACGTGACGGGCGTGTCGGA
AGGGCACACGGCGGTGCTGCGGCTGGTCGGCGTCGGATACAGGGCGACGGTGGAGCAGCGACCGGAGAAGGAGGAGTACG
CAGGACAGAAGTTTGTGGTGCTGAAGCTGGGATTCAACCACCCGGTGGAGATGGGGGTGCCGATGGGGATTGCAGCCAGC
ACGCCGCAGCCGACGCGGGTGTTGCTGGAGGGCATCAACCGGGAGGAGGTGATGTCGTTTGCGGCGGCGATCCGACGGTG
GCGGAGACCGGAGCCATATAAGGGAAAGGGCATCTTTGTCAACGACGAGACGATCAAGCTGAAGCAGAAGAAGATCAAAT
AG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62